Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi: [cgc4525]:Ce-cds-2   

[cgc4525]:Ce-cds-2RNAi_reagentT08D2
MethodRNAi
WormBaseIDWBRNAi00004975
ReferenceWBPaper00004525
Experiment Author (11)
Date01 Feb 2001 00:00:00
Remark Suppression of recombination by >10X
eq. to RNAi:[cgc4525]:Ce-cds-1; Ce-cds-1(Y60A3A.12) and Ce-cds-2(T08D2.7) are >95% identical
The extensive embryonic lethality seen in F2 progeny may be a consequence of errors during meiotic chromosome segregation
template RT-PCR (cloned)
primer CGGTCACCCGAGACGACA
primer AAAACGCAATAAAATGGGGGGCT
DeliveryDelivered_byInjection
Results Phenotype Him Remark% males
Quantity1518
Stp Remark% lethal F2 progeny
Quantity9091
Phenotype_summary (7)