Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi: [cgc4576]:gpc-2   

[cgc4576]:gpc-2RNAi_reagent[cgc4576]:gpc-2
MethodRNAi
WormBaseIDWBRNAi00004988
ReferenceWBPaper00004576
Experiment LaboratoryJA
Author Gotta M
Ahringer JA
Date01 Mar 2001 00:00:00
Inhibits WB_Predicted_geneF08B6.2 Inferred_automaticallyRNAi_primary
WB_GeneF08B6.2 Inferred_automaticallyRNAi_primary
Gene_targetF08B6.2 WormbaseBLASTBLAST_wormbase_primary
WB_HomolHomol_homolF08B6:RNAi
WB_Uniquely_mapped
Remarktemplate RT-PCR, primers CGGGATCCGAATGGATAAATCTGACATGCAACG; CCCAAGCTTTAGAGCATGCTGCACTTGC
DeliveryDelivered_byInjection
Results Phenotype Emb RemarkDIC phenotype -- spindle orientation defects in early embryo
Penetrance75
Phenotype_summary (7)