Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5194]:emb-9   

[cgc5194]:emb-9RNAi[cgc5194]:emb-9
Sequence[cgc5194]:emb-9
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_Gene (6)
WB_DNA_text[cgc5194]:emb-97562aaattttattcaaatcaaataaatttttattttcagattacgaacattagggaaatacaataaaataacagaatcttgttttcaaagggggcaggagtaattcgtatcacacagaacttgctctcttttggcagttttgttagtatggaagattttttgttgaagaaacattgtaaaaagcatagaaaatggttgatatttaatagagagaaaatataaagaaagatttaagtagaacttgataaatagtaaaaagcgagtgatgattgggatgattatcggttcttgagacacacttggcatctggatacacgatctttaagtcctccagctttgagtgtctgtgacattggtttacggaattgcttgtcctggaattattcaattattttgtgaagtaatattttattttttgccgcaattttgggcaattctactttctataaaacaacatatggcaccatgccgttcgttccaaataaagaaaatagattgatttatatgtaaatagcatctatttcagctgaaaatccgaaaaattttttttttaagtattacaaaagtctggaaattgccgattttcaaacaacaaagctttatacctcgatagttctataattcgaccattgacaactttcagaccatttttgaaaattttctagaatgtttcagcttaaataaatattattttcagataaatcaagttataactatttttctatatttcgaggttatggtcattttgtagaattgcagccaaccccattccaaaataattcaaaatttacctgatcaacgatggaaagccagaatccgtgattggtggcataataattgcatgttcctcttccgtggcactcaatgaatggaacggcacggaactcttcgagacaggaaccaggcgattgaagactttgtccagttccttcggctccagcggcagtgtgcatgacaaaggaatatccggtccacatacccgaccatccttgtggacattgtggaactgatgtgtcttgagagtgaactgcgatgatttgagttggaacttcacagacggcacaacgagaaatgtatggacgaattgctgttccggtgactggattcatcattggtgtcattggctcgtcagttgacaaccagaacgagtaatcgttacggctggaaacgtggcagacgctgttcatattacagaacatgaatggcattgtgttgaatttggagaggcaagatcctggttgaccaagatcttgtccactggcacgaccgtttccttgaacgtaaagaagagaatatccttcccaaagttgagaagctcctggtgggcactgtggtactgcggtagtctgagagtgcttggcaaaagtgaatcctcgacttggtgcccatcctcctggtgatcctgggtatcctggagtacctggaagtcctggattaccagtacgtccagcagctccttggaatccttgatctccaccgtgtccaggcattcctgaaagacctggtggtcctggatagccgtctgttcctggagctcctgggtatccggcttttcctggtggtccggaaagtcctggaaaatattttcaattgaattttaatttagaatatcttaaaatatgttaactcaccgttatctcctggaagtcctgggtatcccttctctcctggataaccattttctcctggttggcctggcgggtttctaactgccatagccattggtccgggcaatccttcacgtcctggtcgacctggaagtccgtcgagtccgtcgcgtcctgggaatccatcatctccacgtggtcccttgattccaggttgtcctggtgctcctggataaccgttgtcaccagatcgtccttgttgtcctgggacacctggaagaccacgctctcctggatatccgttgcttcctggggctcctggagctcctggataaccgtcttctccacaatctccttcaagtcctggaactccctcaactcctggtacacctggtgctcctgggagtccatcatgaccgcgctttccgtcgagtccgggaagaccacgttctcctggatatcctggtagtcctgattctcctgggcctcctggaagacctggcattccgtattgtcctggagatcctggttctccattaagtcctggggctcctgggagtccatcaagtcctgggtagccatcttgtccagcttgacctggtgggccatatatgtcttgtccgggtgctcctgggtatccatcgtctcctggtggtccaactggtcctggctgaccatctcttcctggcaatcctggctgtcctggctgacctgattctccacgaagtccaggttgtccatcacgtccctgatttccgttgtctccattttctccaggtgctcctggatatccaacgtctcctggagttcccaattgtcctgcggatcctggataacctggctgaccatccaaaccattttctcccttgagacctggctggccgtcttgtccacgaagaccagggagaccattttctcctggaattcctggatatcccttctctccttcacgtccttgctgcccaggataacctggttgccctggagatcctgggaacccatcttcaccacattctccttcaagtcctggttgacctggaatgccgtcatttccttgacgtcctggaagtcctggaagtccagattctcccttgagccctggcatcccagtgattcctgggtatcctggtggtcctgggactccatcaagtccgtcatatccagcatctcctggttggccgctcaatcctgggtttcctggataactatctccattgtctcctcgttcaccattcagtcctggaaggccgtcttgtcctggaagacctggtggtccatctggtcctgggtatccaaccttaaatttttcaattaatcaaggaatcacataaagtaggttcgatcagtggtgagatttcaggtttgttataatctattaaaacttacatctcctggctgtcctggatatgcgaggtttcctggttctcctggctgacctctgtatcctggtgtacctggctctccggcttctccaacaaaacctggttgaccatcagctcctggaagccctggtagcccgtcggttccgtgttctcctgggtaacctggaacaccatcaagtcctctggatccttcctctccgcattctccctccaatcctggaagaccattgtctccgtgttcaccacgaagtcctgggaatccgacaagaccgtcctctcctggaattccacttggccctgggtatccgtcttgccctggggatcctggatatccttgatctcctggtgctcctgggtatccatccattccattttgtcctggggctccagcctctccggaatatcccggtccaccgtcttgtccacgtgttcctggggttccatcgcgtcctttctttccatcaattccaacaagtccagactctccacgagatcctggctgtcctggggctccatcttgtccgttcattcctgcttctcctgggtatccaggagttcctggaagaccgtctcttcctgggtagccgtctggtcctggaagtccagctgccccagcatctccatttggtcctgggtatccgacttgtcctgggaagccaaatccagtctctcctggagctcctggagctcctggtgctccggggtatccgtcaagacctggctctccacagtccccatcaattccgttgaaaccaacttctccttgctgtccacgcattccaggctctccatggagtcctgggaatcctggaagaccatccataccgcgctctcctggtgttcctgggtatccgtctggtccaacctgaaatttaaaatttatttcagaaatagaaataatcaaaaataaaacacttaccggtcctgggagtcctggaagaccatcagctcctctatctcctggaagacctggcatgccgtcaacacctggttgtccagcaacttgattgacaattctcaatggtgctggaattccccgtggtccttgagctcctggaagtcctggaagaccatcagcacctcgttctcccttgtaaccaggtgttcctggctgtcctgggaaagagtctccaggtggtccttgaagtcctgggattccgagctgaaaattgaaatagtttataatgttttttaatgtttaaaaaatcatgagcttaattagaagcttaaattatccttgaaatatataactcacagatccttgacgtcctctcttcccatcaattccagcaagacctggttcaccttggagtcctgggaatccattttgtcctggtcctcctgggtaaccagggagtccgtcacttcctggtcgtcctggtagtcctggaagaccatgatctcccttaagacctggaattccagctgggttttccattggtccaacgatctctccggcttctcccttcattcctgggtagcctggaattcctggaagtcctggtgatccctgtaaaaaccgaatttgtgtttaatcagcaactttactaacgactgcaaacttactgaaagtccatctgatccagcggatcttggctttcctggagctcctggcattccgcagtctccatgatcaccattaggtcctggtggtcctggatatccattcattccggggaatcctggatctccagcatttcctggaacaccatctggacaatatccacagtcttctcctctttctccattgtttcctggtggtcctggataaccgtcaactccaatacgtcctggcattcctggctctcctggcaaaccggtcattcctggtggtccaactttgttaactccagttcctgggaatcccttttctccagaataacctggatctccgatgtctcctggaataccagggaatccatctcttccggattgtccgtcaagtccaggtggtccttgaatatcgtatcctggaagaccatcctctcctggataaccacaatctcctggttctcctgggagtcctggttcgccagcgaatcctgggtaaccgtcctctcctctatctcctttttcggtgtatcctggcattccatcgataccgggctgtcctggggctcctggagctccaactggacctcttggacctactggtcctgggagaccatcatgtcctggcaatcctttgcctccttgaactccgtcgaatccttgagctccatgtggtccagcctcaccagttccttctccaagtggtccttccggtccacagtctccttcgaaacctggtcttcctgggtatcctggttctccagcccctcccttagttcctgggtatcctggagttcctccaagtccttgttctccttgggatcccttttctccataatttcctggaactccgtcctttccacgtttaccctgcaaaataaaaacttaagttttttattagggcaaatacttacacgttgtccagcatctcccaaatctcccttctgtccctttaatccaggatatcctggtggtccgtcaagtccgagcattcctggtggtcctactggtccatcacgtcccttttctcctttcactcctgaaatggtaaacttcttatatagtttttaattatttaaaattaaaaaaaaccaaccagctggtccgacaggtccttgcaagacttccatctcaattggctttgaagcccatggataagatcccggttgtcctggtggtcctggtggtccaggcaaacccttctctcccttaacaccagaagttctcactcccattcttcccttcaatccagaaactccggggaatccgggaagaccgtacggtcctggatctccctttgctcctttcaatccaggataaccagagtttcctggaagacctggaactcctgatcttccagattctcctttaactcctttgcgtccttgtgaattgacacctccttctcctggtggtccggagagtcctggtcgtccagggtttccgttttgtccagattgccctggaggtccagcaagtccgggcattccagggaaaccctgaaagttttgtttttattttgcttccagttattgaaaattataactatttttgttgtaaaattgattattccaattaatttttaggaggattttttttccagaaaatgtttataaaaatcactatcttcagtttttttcagtttcctctggtcaataattatagtgcaattagtcaatgtgtggggaccgcgacacttgagaaaaagatgcaagatgagtcattacacatcccgatgctctatacacataaaaagcactgcatctatctatctctcactttttctgttttctgtttcaccgctggactcgaaggagcttaaaactcaaaaaaaacctcaagacactaacaacatctgacaaatgaataatattacatatatcacttttggaaaggtcacttacatctgttccattgcatcctggaattccttcttctcctttcagtcctggtaatccgtcaagtccttgaagacctggatgacctggcgatccaggaagaccacgatctccacgagctcccttagatcccatatctccaaaatctccttcggctcctgaaatatggaattttttatttttaagatttttgatatttttaagatctttttcagtgtaagaacttactatttaaaaaaggttaaaacgtcttctttaaatagttttcaatagaaaaaagtgcattcaatcgaattttcaaagattttggtattaccgtaataaatagtgaaatacatttcttcagaattataaaaaatgcatttagttattttttttagcttatcattttgatatacgattaccagtgtaacatgaattcaatattaaaaattgtttttatttttatttttgtgtttctatttaattaattttttcaaatcggtgtttttttttgttgatattttcagcaaaccatttaggtcttttttttgtaaaatatttctaatttaaacttaaaaactcaccaaacattcctggagctcctggtgctccttctggtccatcttgtcctggtgctccaggatgtcctggttcaccaccaaatcctggattaccacgttctcctttggttcctgggcaaacacatggtggagcacatcccttgcatgcggcggcagcatccacatgtatcctgaaattaaaaattgcaatgggataaattatagataatcatttcaggcaaggtgagggcagggggactttagccagatcagtaatgcacattttagggccttttcttgattatttatttttttagaaattgccgctgaaactttcaaaaaatatttgtttcttattcattcatttttctgaaagttcgaaccaagtttgttttatagtttcgaatgaatttaaagttttatatagtttttttttcacattcaaatttttttaaaacaactcacctatcttgacagaacgacgacagtagcactacggctgccgtcaagccgagaagcgataagcgtgacatcttccagtcacggcgatcgacttctcgttacccaaagattggtgtcgttctg