Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5194]:emb-9   

[cgc5194]:emb-9RNAi[cgc5194]:emb-9
Sequence[cgc5194]:emb-9
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_Gene T15B7.3 Chunk_score Abs_score377
Specificity_index0.066
Rel_score0.082
B0222.7 Chunk_score Abs_score333
Specificity_index0.058
Rel_score0.073
F23H12.4 Chunk_score Abs_score121
Specificity_index0.021
Rel_score0.026
F59E12.12 Chunk_score Abs_score209
Specificity_index0.036
Rel_score0.046
K04H4.1 Chunk_score Abs_score5098
Max_abs_score5098K04H4.1
Specificity_index0.796
Rel_score1
M18.1 Chunk_score Abs_score133
Specificity_index0.023
Rel_score0.029
WB_DNA_text[cgc5194]:emb-97562aaattttattcaaatcaaataaatttttattttcagattacgaacattagggaaatacaataaaataacagaatcttgttttcaaagggggcaggagtaattcgtatcacacagaacttgctctcttttggcagttttgttagtatggaagattttttgttgaagaaacattgtaaaaagcatagaaaatggttgatatttaatagagagaaaatataaagaaagatttaagtagaacttgataaatagtaaaaagcgagtgatgattgggatgattatcggttcttgagacacacttggcatctggatacacgatctttaagtcctccagctttgagtgtctgtgacattggtttacggaattgcttgtcctggaattattcaattattttgtgaagtaatattttattttttgccgcaattttgggcaattctactttctataaaacaacatatggcaccatgccgttcgttccaaataaagaaaatagattgatttatatgtaaatagcatctatttcagctgaaaatccgaaaaattttttttttaagtattacaaaagtctggaaattgccgattttcaaacaacaaagctttatacctcgatagttctataattcgaccattgacaactttcagaccatttttgaaaattttctagaatgtttcagcttaaataaatattattttcagataaatcaagttataactatttttctatatttcgaggttatggtcattttgtagaattgcagccaaccccattccaaaataattcaaaatttacctgatcaacgatggaaagccagaatccgtgattggtggcataataattgcatgttcctcttccgtggcactcaatgaatggaacggcacggaactcttcgagacaggaaccaggcgattgaagactttgtccagttccttcggctccagcggcagtgtgcatgacaaaggaatatccggtccacatacccgaccatccttgtggacattgtggaactgatgtgtcttgagagtgaactgcgatgatttgagttggaacttcacagacggcacaacgagaaatgtatggacgaattgctgttccggtgactggattcatcattggtgtcattggctcgtcagttgacaaccagaacgagtaatcgttacggctggaaacgtggcagacgctgttcatattacagaacatgaatggcattgtgttgaatttggagaggcaagatcctggttgaccaagatcttgtccactggcacgaccgtttccttgaacgtaaagaagagaatatccttcccaaagttgagaagctcctggtgggcactgtggtactgcggtagtctgagagtgcttggcaaaagtgaatcctcgacttggtgcccatcctcctggtgatcctgggtatcctggagtacctggaagtcctggattaccagtacgtccagcagctccttggaatccttgatctccaccgtgtccaggcattcctgaaagacctggtggtcctggatagccgtctgttcctggagctcctgggtatccggcttttcctggtggtccggaaagtcctggaaaatattttcaattgaattttaatttagaatatcttaaaatatgttaactcaccgttatctcctggaagtcctgggtatcccttctctcctggataaccattttctcctggttggcctggcgggtttctaactgccatagccattggtccgggcaatccttcacgtcctggtcgacctggaagtccgtcgagtccgtcgcgtcctgggaatccatcatctccacgtggtcccttgattccaggttgtcctggtgctcctggataaccgttgtcaccagatcgtccttgttgtcctgggacacctggaagaccacgctctcctggatatccgttgcttcctggggctcctggagctcctggataaccgtcttctccacaatctccttcaagtcctggaactccctcaactcctggtacacctggtgctcctgggagtccatcatgaccgcgctttccgtcgagtccgggaagaccacgttctcctggatatcctggtagtcctgattctcctgggcctcctggaagacctggcattccgtattgtcctggagatcctggttctccattaagtcctggggctcctgggagtccatcaagtcctgggtagccatcttgtccagcttgacctggtgggccatatatgtcttgtccgggtgctcctgggtatccatcgtctcctggtggtccaactggtcctggctgaccatctcttcctggcaatcctggctgtcctggctgacctgattctccacgaagtccaggttgtccatcacgtccctgatttccgttgtctccattttctccaggtgctcctggatatccaacgtctcctggagttcccaattgtcctgcggatcctggataacctggctgaccatccaaaccattttctcccttgagacctggctggccgtcttgtccacgaagaccagggagaccattttctcctggaattcctggatatcccttctctccttcacgtccttgctgcccaggataacctggttgccctggagatcctgggaacccatcttcaccacattctccttcaagtcctggttgacctggaatgccgtcatttccttgacgtcctggaagtcctggaagtccagattctcccttgagccctggcatcccagtgattcctgggtatcctggtggtcctgggactccatcaagtccgtcatatccagcatctcctggttggccgctcaatcctgggtttcctggataactatctccattgtctcctcgttcaccattcagtcctggaaggccgtcttgtcctggaagacctggtggtccatctggtcctgggtatccaaccttaaatttttcaattaatcaaggaatcacataaagtaggttcgatcagtggtgagatttcaggtttgttataatctattaaaacttacatctcctggctgtcctggatatgcgaggtttcctggttctcctggctgacctctgtatcctggtgtacctggctctccggcttctccaacaaaacctggttgaccatcagctcctggaagccctggtagcccgtcggttccgtgttctcctgggtaacctggaacaccatcaagtcctctggatccttcctctccgcattctccctccaatcctggaagaccattgtctccgtgttcaccacgaagtcctgggaatccgacaagaccgtcctctcctggaattccacttggccctgggtatccgtcttgccctggggatcctggatatccttgatctcctggtgctcctgggtatccatccattccattttgtcctggggctccagcctctccggaatatcccggtccaccgtcttgtccacgtgttcctggggttccatcgcgtcctttctttccatcaattccaacaagtccagactctccacgagatcctggctgtcctggggctccatcttgtccgttcattcctgcttctcctgggtatccaggagttcctggaagaccgtctcttcctgggtagccgtctggtcctggaagtccagctgccccagcatctccatttggtcctgggtatccgacttgtcctgggaagccaaatccagtctctcctggagctcctggagctcctggtgctccggggtatccgtcaagacctggctctccacagtccccatcaattccgttgaaaccaacttctccttgctgtccacgcattccaggctctccatggagtcctgggaatcctggaagaccatccataccgcgctctcctggtgttcctgggtatccgtctggtccaacctgaaatttaaaatttatttcagaaatagaaataatcaaaaataaaacacttaccggtcctgggagtcctggaagaccatcagctcctctatctcctggaagacctggcatgccgtcaacacctggttgtccagcaacttgattgacaattctcaatggtgctggaattccccgtggtccttgagctcctggaagtcctggaagaccatcagcacctcgttctcccttgtaaccaggtgttcctggctgtcctgggaaagagtctccaggtggtccttgaagtcctgggattccgagctgaaaattgaaatagtttataatgttttttaatgtttaaaaaatcatgagcttaattagaagcttaaattatccttgaaatatataactcacagatccttgacgtcctctcttcccatcaattccagcaagacctggttcaccttggagtcctgggaatccattttgtcctggtcctcctgggtaaccagggagtccgtcacttcctggtcgtcctggtagtcctggaagaccatgatctcccttaagacctggaattccagctgggttttccattggtccaacgatctctccggcttctcccttcattcctgggtagcctggaattcctggaagtcctggtgatccctgtaaaaaccgaatttgtgtttaatcagcaactttactaacgactgcaaacttactgaaagtccatctgatccagcggatcttggctttcctggagctcctggcattccgcagtctccatgatcaccattaggtcctggtggtcctggatatccattcattccggggaatcctggatctccagcatttcctggaacaccatctggacaatatccacagtcttctcctctttctccattgtttcctggtggtcctggataaccgtcaactccaatacgtcctggcattcctggctctcctggcaaaccggtcattcctggtggtccaactttgttaactccagttcctgggaatcccttttctccagaataacctggatctccgatgtctcctggaataccagggaatccatctcttccggattgtccgtcaagtccaggtggtccttgaatatcgtatcctggaagaccatcctctcctggataaccacaatctcctggttctcctgggagtcctggttcgccagcgaatcctgggtaaccgtcctctcctctatctcctttttcggtgtatcctggcattccatcgataccgggctgtcctggggctcctggagctccaactggacctcttggacctactggtcctgggagaccatcatgtcctggcaatcctttgcctccttgaactccgtcgaatccttgagctccatgtggtccagcctcaccagttccttctccaagtggtccttccggtccacagtctccttcgaaacctggtcttcctgggtatcctggttctccagcccctcccttagttcctgggtatcctggagttcctccaagtccttgttctccttgggatcccttttctccataatttcctggaactccgtcctttccacgtttaccctgcaaaataaaaacttaagttttttattagggcaaatacttacacgttgtccagcatctcccaaatctcccttctgtccctttaatccaggatatcctggtggtccgtcaagtccgagcattcctggtggtcctactggtccatcacgtcccttttctcctttcactcctgaaatggtaaacttcttatatagtttttaattatttaaaattaaaaaaaaccaaccagctggtccgacaggtccttgcaagacttccatctcaattggctttgaagcccatggataagatcccggttgtcctggtggtcctggtggtccaggcaaacccttctctcccttaacaccagaagttctcactcccattcttcccttcaatccagaaactccggggaatccgggaagaccgtacggtcctggatctccctttgctcctttcaatccaggataaccagagtttcctggaagacctggaactcctgatcttccagattctcctttaactcctttgcgtccttgtgaattgacacctccttctcctggtggtccggagagtcctggtcgtccagggtttccgttttgtccagattgccctggaggtccagcaagtccgggcattccagggaaaccctgaaagttttgtttttattttgcttccagttattgaaaattataactatttttgttgtaaaattgattattccaattaatttttaggaggattttttttccagaaaatgtttataaaaatcactatcttcagtttttttcagtttcctctggtcaataattatagtgcaattagtcaatgtgtggggaccgcgacacttgagaaaaagatgcaagatgagtcattacacatcccgatgctctatacacataaaaagcactgcatctatctatctctcactttttctgttttctgtttcaccgctggactcgaaggagcttaaaactcaaaaaaaacctcaagacactaacaacatctgacaaatgaataatattacatatatcacttttggaaaggtcacttacatctgttccattgcatcctggaattccttcttctcctttcagtcctggtaatccgtcaagtccttgaagacctggatgacctggcgatccaggaagaccacgatctccacgagctcccttagatcccatatctccaaaatctccttcggctcctgaaatatggaattttttatttttaagatttttgatatttttaagatctttttcagtgtaagaacttactatttaaaaaaggttaaaacgtcttctttaaatagttttcaatagaaaaaagtgcattcaatcgaattttcaaagattttggtattaccgtaataaatagtgaaatacatttcttcagaattataaaaaatgcatttagttattttttttagcttatcattttgatatacgattaccagtgtaacatgaattcaatattaaaaattgtttttatttttatttttgtgtttctatttaattaattttttcaaatcggtgtttttttttgttgatattttcagcaaaccatttaggtcttttttttgtaaaatatttctaatttaaacttaaaaactcaccaaacattcctggagctcctggtgctccttctggtccatcttgtcctggtgctccaggatgtcctggttcaccaccaaatcctggattaccacgttctcctttggttcctgggcaaacacatggtggagcacatcccttgcatgcggcggcagcatccacatgtatcctgaaattaaaaattgcaatgggataaattatagataatcatttcaggcaaggtgagggcagggggactttagccagatcagtaatgcacattttagggccttttcttgattatttatttttttagaaattgccgctgaaactttcaaaaaatatttgtttcttattcattcatttttctgaaagttcgaaccaagtttgttttatagtttcgaatgaatttaaagttttatatagtttttttttcacattcaaatttttttaaaacaactcacctatcttgacagaacgacgacagtagcactacggctgccgtcaagccgagaagcgataagcgtgacatcttccagtcacggcgatcgacttctcgttacccaaagattggtgtcgttctg