Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5194]:lin-26   

[cgc5194]:lin-26RNAi[cgc5194]:lin-26
Sequence[cgc5194]:lin-26
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_Gene F18A1.2 Chunk_score Abs_score374
Specificity_index0.563
Rel_score1
F18A1.3 Chunk_score Abs_score616
Max_abs_score616F18A1.3
Specificity_index0.437
Rel_score0.775
WB_DNA_text[cgc5194]:lin-262796aatggagtcaattgttagatcaatgcttcggagtcacatatcgaaagtggaagcatcataaggaggatacgcagcacaccggtgggttactgttcgatgacgacgagttgagagggtgagcgagagcgtcaccgacatcaactgaagaccgccagtgtagtctttgcagcgggtgatgaagattacggtcacgagcatcatttttcaccggaggaagatgtaatgacaactttatgattcttcatggctttcacttgtcgacgtcttcccattgtcttccattcatctttcgtcatctcttcatatttcactcaatcactgccttgtgcgatcatgtaatttcaaactattgtaattcgttgaaattatcaaataataaatttaatcaggttattattgaatgtttatgtaacctattccatctcacaatgagttaatacaactcttgaatacttgaataccttcatccctcgcttactttttttaaaatttttaattgattattttcagatgctttctaaatttgtggtagtcgaagtaagcaactcaaataacacaatgacactggtggaatacttggtatgtttatcatttaaaaagttcgattaacattggtattttcaggtaacgcatggattcgacaagtttgcagttgtaacagatttagttgatcacccttctttcaagtacaaggatggttcatcaagtcccgaatctccatcaacaactgcttcaactgctgcccaacacacaccaccacgaacagcagtttcaacacctacatccatcaacactccagttccaccacatcaaaacaaacagaggcattcaattgacaaaatcgctgcaaatttatccaccaaaaaggtttcaccatcatctattgagaagcagctccaaagaacatctcataatcctcttcatcaactatctaccccacatgcattgagtcaactacagaaattgctggaggagcagcacaagattaatcagatgaatattcagaaaaaggaacaggagaggcagcaagctgagattcaaagaattctgctccaacaggcaaatgctgctcagattaatcactcatttggattagaaaggctaacaccagaatatgatgataatcatcatagtgaaacaatatctaaagctagctctgaagatttgaagactgagcccgattcaactgattttgggcttggaacaagcgacgatcaagtacgtgcttcaatgcttcatctgcttcatccagtatttgctccagcttttgggatgcttgatgccgagaatatctttggagctgcatcaaaaccaacgacgcctgcatcaaaacgacgaaacactgattcaaatggtgctccatcgaaaaaacatcgttggctcccagtcaatgagcttgaagagagtcgatcatcgcgaggaaagaactgcggaagagttcattgcaaggccacctacaagtgtgcactctgtggaaagccaacaacactcaactcaacaggatctcgttggaatcttctgcgccacgtcatcatgatccattcggattgtaagccatataaggtgagtataagtgtttcaaaacttttttgcatgattgtgtattgtctattaaagtgctaacatgtccccctattaaccttatccatgtattgtgttgttcatgaatttttgtgtgatgcgtgcagtttgtagctgtgttcttttgcagtgttgggattgtgacttcaccggaataaaatccaacgttatctcccacgccaggcaatgtcgtcacaacgccgaagatgcccatgacattacgtaagtttaaacaattataatgaaaccattgtagtgcagtagtgtgaagtgaaaagctatctattttttttattagtattcgagtttcgagtgatatatgcatggagtgttccatattccattccctaaacttcctcccaattcccctacttccttcataatcatcacataacaatctctgcaaattcttattttcagtaccgacgagatgcgtgccgaatggaatctccgccttcacgaatgcttcccagattatgtgcgtgctaaagaacgtggatggcaaccagaggaggttactgtaaagaaagaagaagtagaggagtctccaactcttgtcaaacaagaactcactcttgttaaacaagaacccacttttgccgagcaactcgagccaatggctcaaccattggtgtagttcgaagcagctattcatagatgaattttgcaattcaatactagcctttaattacttttttctattgttatgatgatacatatcttagccctccccaatcaatatctatgcacattgatcaccttgcccactttttaacaaaccattccaatctgaatacaccttgcctctcatttgctttttcattccttccgattattgttctgtgatatttccttccagtatttcgttctggttgtgccttttcattcacccgcaggtccggttaattgaaagttcactttgcccccacaaattttgcctttatcttctctgttacagtgccttaattcactttttccattgtacaccttttttaactttactctttgccacaccattcagtttctcgacgggtatttatgttgaatgatagcattctttcatcagcattcgagatttcttatgtacatctgatcatattttctcaagcataatctgaaattctttccattttccctgtaacgcataatatgcaatttagcataatgcgtttttttgcaattctctagaagcatctaataaaaattaaataatac