Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5235]:itr-1.2   

[cgc5235]:itr-1.2RNAi[cgc5235]:itr-1.2
Sequence[cgc5235]:itr-1.2
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneF33D4.2 Chunk_score Abs_score677
Max_abs_score677F33D4.2
Specificity_index1
Rel_score1
WB_DNA_text[cgc5235]:itr-1.2764acaaatcacaacttggtttctgaaactcttagcttcttggatacagtctgtggatctacaaaaggaagtcttggagtgtttggtgaaattggagagcacaatttctctcttattacacaaacacttgccacgttgactgaattctgtcaaggtccatgtcatgagaatcagaatacaatggcaatgcaagaaaatggactgaacattatcatttccctggttctaaatgagatcaaaccacttgctgatgatcatatggaacttgctttggaaattaaaagtcaggcttcaaaattacttttggcaattatggaatcaagacacgacggagagaatgctaatcgagtccttagaaatatggcaaatatgtccggaggtccaaagcaattggtacatgcaatcaagcaagcatatgaaatgactaattcaaatcatcatatgctaaaatcaattagtcgagatttgttcagacaagctgaagatgatttgaaaaagaagtcaggcccacaaataactgtcaatacaggtgagaaaatctggtccaaatattaataagttttctaaatttcagtgactcttcctgaaatcaatgtagatgcttctggaattgtatcaattcatactgagaagaacatttccagttcgctagatgataagttcaatgatgatgatattccaagtgtagatcctcgagaagttggtcataacatttatattcttgctcatcaacttgctattcacgatggagaattagagatttggtt