Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5259]:ptp-3   

[cgc5259]:ptp-3RNAi[cgc5259]:ptp-3
Sequence[cgc5259]:ptp-3
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneC09D8.1 Chunk_score (4)
WB_DNA_text[cgc5259]:ptp-32359gagctcgtcgagcaaccgtgccaggagcatatgtgactgcaaggttgagtgctgatcgagtcaagcaacaatacaggaataatcaaccatttattgtgggagattcacaggtatgtttttttcaactcacctccactgctcgactttaacagcttatatgttggctgatattgggtttatcagaaacgtttccaacaatgaaaatataaagaaatagttgagagacatttttgctgtttccagatttttgattaaagtagactttgaaaaaaaagtattctctattagtattgcaccccattgttcaactttggcagcccatttactcagttgtcgttagttttatacgaaacatgccaacagacaaaatatttcttggttcttttcctatatatttgcagttgataatatttttatgtcttccaaatgaaccgagatataacgtttcaaagtaatgtagttgggtgcaatactattagaggatatacggtagttctagtcaacgttttacatttgaatttccaatgtacacagttgttatagcatataacatctgcaagctttttgaaccaaaaaaaataaattcattgttttttgtgttcactcttctccccctccccaagttttctatgtctccatgaataaataatcgaaaacgcttgcttagcgccgggctcttgtcgcgcggcgagaagctcttgtcgttgtcttttatagccccagccagcaggcagtatataccctgtttcgtgtggtcctttgagatttcttgagatttttgccataatatcgaggcacttacggacctttccccctctcctcatacccaaccgccacttcaacaactttttcatttctatatataagcagttctttagattttccattcattccttggtcggttaagtagaaaattgaaattttctgaagctagttgagctttttttcgcatacagaccaattttcgaaattcaaaattcacccacattgtgtagcaatacgatctaactttaaaaaaactacatagaatctagatataaaacgtataaacatttcccacgataaagtagggctattgtttttgtgcaaacattgaaatacatacatcaatatctctacattgcagttgtatgacgggttcaccaactacccactcgagcacaaccttcactaccgactgatgatgcgggcgtttgcgaaaaatgatgtgcgaaccaaggacagtgtaagtttacttttcccgttttttttttcaagatagatcgacatcatttttaaatttgaatccaacttttttaattcgaaattttcagttcgaacaacgtgcaccaatgagcgagaagctgtcccgtatgtactctgattctgttctaactgagccattcacaatcaaatcggctcttcgcggagcttcgcagaagtcgtctccttgggttggagcgtgcatcgccttcttggtcttgttctcgattgttggaatgctgatatgttggtggttgcgttgcaataagaagtctgctggacggcatccacgacatggttctatcacaaaggttgcgttgactggaaatattatgaatggaggtggtggaatacctggagaaacaagcaagttattatcgacttccaatgaatacggacgacagattatgaacccctatgagcagatgaatggaaatcatcatatggaatcatcgatggatctttatcctttgccaacaagtcactctagatctaatggatatgcacctgttcctgtcgcaataccatctcttccaaataatggaaacaatatgactacagtatcccatccagctgttccgatagctgaacttgcgaatcatatcgagaggcttcgaatgaacaataatgcaggattccagtcagaatttgaatctattgaaactggacaacacttcacttgggaacactcgtctgctgatatgaataagcataagaatcgatacgcgaatgtggctgcctatgatcattccagagttgtactttccaatgttgaaggatatccaggaatggattacatcaacgcaaattatgtggatggatatgacaaaccaagaagctacattgccacccagggaccactcccggaaacattttcggatttctggagaatggtttgggaggagcaatcggttacaattgtgatgttaacaaatctggaggaacgaagtcgagtgaaatgtgatcaatactggccgagtcggggaactgccacatatggagatatcgaggtgacactgttggaaagcgttcatttggctcattatacgatgagaacgatgcgattgaaaatggttggagaacctgaagttcgagagatcaagcatctacagtatac