Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5260]:cki-1   

[cgc5260]:cki-1 RNAi [cgc5260]:cki-1:1
[cgc5260]:cki-1:2
Sequence[cgc5260]:cki-1
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneT05A6.1 Chunk_score Abs_score762
Max_abs_score762T05A6.1
Specificity_index1
Rel_score1
WB_DNA_text[cgc5260]:cki-1864aggtttcctcactcttttcaaatgtcttctgctcgtcgttgccttttcggtcgtccgacgcccgagcaacgctccaggactcgaatttggcttgaagatgctgttaagcgcatgcgccaggaagaaagccagaaatggggattcgactttgaactggagactcccctcccaagctctgctggattcgtttatgaagttattccagagaattgtgttccggagttctacaggtaattgaattttataaatttttcatagttattttactaaacagtttcatttttcagaaccaaagttctcactgtcagaaccacatgctcatcgctggacatcagctcaacgactttgactccattgagctctccgagcacatctgataaggaggagccctcgctgatggatcccaacagctcgttcgaagatgaagaggaaccgaagaagtggcaattcagagagccaccaactccacggaagaccccaacaaagcgtcagcagaagatgaccgacttcatggcagtttcccgtaagaagaattcgttgtctccaaacaagctgtctccggtgaatgtgatcttcactccaaaatctcgtcgtccaacgatcagaactcgatcttcatgctctccatactagaggtttcattttgacttttttttgcccaattccacgggttgaatctaatcatttgattatctcctcgacagtttctgagtctctcttaattgttcaactagtcatgtttccacaaatgttttattgtttgttccaaaagccctgtgatccatgtttaggaactctgtaactcttttttcccattgccatttgttttaaacaactcaaagaaaaataaaccctttgaaatta