Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5264]:smc-4   

[cgc5264]:smc-4RNAi[cgc5264]:smc-4
Sequence[cgc5264]:smc-4
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneF35G12.8 Chunk_score Abs_score4624
Max_abs_score4624F35G12.8
Specificity_index1
Rel_score1
WB_DNA_text[cgc5264]:smc-45604atgcctccgaagacttcggcggcgccgccacaatcagacgaatctgattctgattttgatgacgctcctgttaaaaagccgcagaaaaagacaacgaagcctgtgaaccgacacaaggaaggatcaaaggacccggaagaagaactacaggtatccctctcagaatatttaaaagcagcaataaaactgaaatttttattcagagagcggtaaatgaaaaatttgatggaagcgacggagaggacgacgacagtgatcttttctcattggtatgttactctgtttttaatattaaagtcattacattttacagcaactgccatcgcgacccgatttccttacaaaaccgaatcgggcggatcgtttgatgattcgcaatgttgaagtggacaatttcaagagttacttcggcaaggcttccattggaccatttcacaaaagtttcacatcaattatcggtccaaatggatctggaaagtctaatttaatcgattcgctcttattcgttttcggtttccgtgcttccaaaattcgttctgcaaaagtgtcaaatttgattcacaaaagtgctggaagaaatccagacaaatgcacagtcactattcattttcagcggatcgtcgatattgtaagtgaatcagagaatctaataaaatataaatttgctttttttcagcctgggcattacgaagtcgtcaaggattctgagttcacaatctctagaactgcttttcaaaataactcaagctcatatgctatcgatggtcgaccggcaacgaagaatgaagttgaagcacgcctacgacgcgttgacattgatattgagcataatcgttttctaattcttcaggtaaaagtgacaataaaaccggtaataaacatttttttcagggagaagtcgaacaaattgcaatgatgaaaccagtgaaaaccaccaaaagtgaaactggaatggttgaatatttggaggatattatcggaacaaaccgactcgagccctttgttaaattattccagcgacgcgtcaatcgtcttacttgtgatctttctcaacaaagaatcgctcgtgatcacgccagaaacagcaaagtagctatggagaatccagttagagctgcaattgagtttctgatgaaagaaaacgaggctacaacgattcatatgaaattggagcaaagaagacggtagttctgaaatattccaggttaaaataacatttaacgttttaaggcaacgatacctagataaaattgctccaaaacaagccgaacttgacaagatgaaagaagaaatgaaatcgattgctgaaacgctggataccaacaaaaacgaatacaaacaatctgaggaagctcagaaagttatgattgaagagcgttcgaaactcgacaaaaactttgatagtctatctaaggaattgagcgacttgggcactgaagagactcgcaggaaggaggctttgaaaaggcatcaagctaatatttcaaaggcggaagctgagaaggaaaaagaggttaaaaagcgatcaaatctggaagcagcacccgaaaaggcggagagaaaaatcgcaaaatgtcaggaagaagtggaacagttgcttgaaatagagaaaacagctaacgaggaagccgacaagaatcttgatgaatttgaaaaacgctctgaagcgccaaaagaagaacaaaagaagattcaagagacttgggcgcagaagagcaacgaatttaacaaagttcgaggtgaagcaaggattgcacgggaagatttcgaggatttaaagaagctcgcgaattctggaacggataagcttatcgaactgaagaaacgattagaatcttcagaagaaagttatgcgaaagagaaggatgagttagataagctgaagccggaatttgattcttggaatgataagttaaaacaactgagtacagaattgccaactcttcgaaatacggcaagacagaagaatcaagatgtaggttttcaaaaagcctgataaatttaaataaatcctattttacagttggcaaaaacgcgtgatcgtctcgaaactcttcgccagcaaaactcgtcttgctcaagttcgaataaagttattcaagccttaatgaaggaaaaagaagctggaagaattaaaagttttcacggtcgtcttggtgatctcggtgtcattgatccgaaatatgagggagcgatttgcacaaatttcggggcccgtctcaactatcttattgtagggaaagaagaagatgcaaaaaatgtcatcaattttttagttgctgtaagttttataaccctcattttctaggaatacattggttttcagaataaattacctcgacaaactgttcagccattggacaaaattaagtgtgataagagagatttagctcccaatccgacgaacccattacctgctcctcgtcttattgatctgattgattgtgatcctgttcttaaaccagcattctatgatatggtgcgtagtgcaattgtgggcgattctacccaggaagctcagcgaatgcatagaatgcccgcttgtcgtggtgttaccgtgtgcacactagaaggttctatgattcacccatctggatcattcacaggaggtggaaaaacagtgaaaggtctcattctcacggataaaaataagatggctaaacaagtgacacctgaagataaagccgctgaacgagatttagctgaaaaacttggaaaattgagagatgaagctgatgaacttaaaggacaagagcatgaagtaagatattaaaggataaaaatataaaatataacaaaccgatttttagatggacggacagctaatcgaagcacgtcgcaaagtcgctgaaatgagtaatcgtttgtctattgtgacttcttcagttcaatctgcagctccagcaattgaaaccctcaagaaaacgatcgcaaatcaagaaaaagaagcagcgaaagttaaggtggatgcgaagacattagaagataaacagaagattgttgaggagctcgaaaaaagtaattttccgtcatatcatcatgatttgggtaatatatttcatttcagaacgagatgagttgggcgaagaagctgcgaaagtaaaagctcgtcaagctgaaattcagagtaagcttgacggaatcttcaaggaacttgtacaatgtcatcgagacgaagccaaagagtctcttcagaaacgtcaaaaacttgagaaggatatcgccaaagaaactgcaaatatttccaattcgggcagaaacattgcaaagtgcgatgagaacatttccagacacgataaagacattgagaagatgaagaaaaagtgcgaagaattgatggagaaagcaatcgatgatgaggaagtgaaatcgaagaaagaaacggttgagcgctttgaaaagcaaatcaagaagttacagacaaaaggagaggaaatgacgaagaaacaatcggaattgtcagctgcagagacgaaattggagggagaattgaaaaagtgcagtgagggaataaaggagttgaaggaaagtatgttggcagatcgattaaaggttgaggatattgaaaagaaggtttgttattaataaaaatctattaaattaaatgttctttttttacagctcgctgctttgaaagttaatcgaatcccacgattccaatttctcatcgaatcaagtcggccagaagatctcgaaatgcaaatcgatgataaaatgccggtggttgatgaaaatcagagtccagaagaagttgaacgacaaaagaagcatatggcctgcgtgatgagtgacgccgcgtacgctctcgagttcgaaatgcgacagaaagtgttggaaaacactgaatcgtatgagaatgtcgacggagaggaccgggtaccggtcgagcttctgtccgacgagaaaatcaacgagatttcgagccgagacgctgaagaaatgcaaatgaagctgaaagtgtgtgaacaacaagtggaagcattgaaagctaaagttgatatctcatcgattaaagcttatgttgataaggtcaagcaatacaatgaacaagtgatcaagttgacaatagccacagaagtacatcgaaaacataatcaagaacttcaacgaatcaagcagatgcgacttgaagaattccatgtaagaaatcagacgttgataggtttctgattaatttttaaaaaatatttcagtctgcattcgaattcattggaaaacatttggttgccgttttcaaaatgctaactgacggaggagatgccaaattggaatacattgataaagacgatccattccgacaaggaatcagttttatggttcgcccagcgaagaaagcttggaagcaaattcaattcctttcgggtggagagaagacattgtcctcattggctctcatttttgcgctccacatgttcaggtactaaatactttctttaataattattataatccctcgtttagacctactccattctacgttatggacgaaatcgatgctgctctcgactatcgtaacgtttcgattattgcccaatacgtccgacaaaagactgaaaacgcgcagtttattattatttctttgagaaataatatgtttgaactcgccaatcgtctcgttggtatctataaagttgatgggtgtactcgtaatgtagccattgatccattgagagtttgtgagatggcgaagcaaattacggacagtttggggcaggccacgtgtactcttcctgatgaagtaactcaacgattcaatgagacaatgagtcggcagaataaggaaatgattgcacaagaaaaacaatatccgaacttcccatcatcaaatgagatttcaaaggccgaaaagattgttaacgttgaaggacgtgtcaggaaagaattgattcaaactacccgagatgtcacttcaagaccacaatccaaagcaacgacaagtggcgatggaactgaaagaccggctagtcggtcagcaagtcgacccgaatctcgtataaatcgtaagaccaatggcgtatttattatgaaaatgaaacaacttatttttagaaatgaaatatcctgctccacgccttgtcgaaagatcgtcgtcacagaatgttcgtagcccgagaaaggcacgaaacatagaggccgatgaggttagtttcattaaaaaatttgagactcattttatttcccattttcagactactccaccttcaaagcgttcaaattccgcaagtacaccaaaacgatctccaatgaaaccgttgacaccgtcgagtaaaaagaaggagaaggcaatcgttgatgacgatgatgatatggaataattcattcaaaaaagttctatcctcttttgttttgacgggtattagttctctgatccctcgactcttccgtttattattattttaaactcgcgcaaatgatactcatgtgcaattctttaacctctccctgttcaagaaatctctcccttttcctttttatttattcttattctcaattatatttaatttgagggccaaagtttgagccattttgcgttgtatttttttttcggctccaaactgtaatttaatgatataattgagctatgtgtcttttcgtttgaaataa