Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5277]:apr-1   

[cgc5277]:apr-1 RNAi [cgc5277]:apr-1:1
[cgc5277]:apr-1:2
[cgc5277]:apr-1:3
[cgc5277]:apr-1:4
Sequence[cgc5277]:apr-1
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneK04G2.8 Chunk_score Abs_score3741
Max_abs_score3741K04G2.8
Specificity_index1
Rel_score1
WB_DNA_text[cgc5277]:apr-15420atgagctctagtagtagtgatgaaaatgaaacaacgatacacagaacaggatcaaataccggtggaagtggaatctactcacaacctcgagcaggatcatcaaaaagaacatcgaatgtgcgacatgatgttagtgatgtagatgatgaagaagagcattatgcaagatttcgcgaagatacggtaaggattgttggaaaaaacagattttcgatgttggtaaaaggccaagttttgactttttgaggaatttgagcaatttttgtacctgtacaatggtcttctaagtaaaaaaaatcggagcgtaaaaaattagaatataaaagtattttttaagctttttaactattttttctgaaaatacaatatttaaaagtttaattacaggcgatcgaggttgacgatgctataacagttcttctttcatctctacatttcgaacacaaacgtgatattgttccgaccgatgaagatgataataaacttcgagaacttcacgaaaagatttttgcattgataacgagtgaatctgatgttaacaggtaaatccgaaattttcagaatatttttcaaaaaatcgtttaattttagaaaaagacggctgaaaaaagctcttcctgcgtcaaactgtgttagagaacaagtatattatcttcgaaggaaaccatcaacaccaccagcttcttattatcatcgactaaatgcagctcttcacacaatcgttaaggaatcatttggagaagaatatcgaaaagttgctacagtattaggacttgttgaagcgcttgcagaagttttaattcttgaagttcacacatttggaatcaatgagaccaatcctggagagcatcgaaatattcgaaaacttattgccaatgctcttacgaatttaacatacggtcaaattcactctaaacgccggctatgctcatatgatggattcattcgatgcgttgttcgaattgtgatcgaatctccaaatataactcaagtatacgctggactaatcagaaatctctcatggaacgccgattcaggaatgagtgaagctcttcaaccaacagttcatgcactttcaattgctgcagtacatgcacatacacatagattcgatgttacagcaacattatctgctttgtggaatcttgctggtcactcagtagagaataaacgaactatttgtgatactccgaattgtttaaaagtattagccagccttctatctcctgatgcaagattcacgtcacttgttgattcagctactggaattctgaagtatgtatcacaatatctcgcgaatacttccacgcatttagaggttagtttttgatttgtttttgttgaaaaatgcaagtgaggtttcaaagttatctttttttttcataaatagaaagaaaaaaatcgaaaaaaatttcatggcgagtcaaaattttgcaaaaaaaaatccaaatcttgctaaatctttcgtcaacttgcgcttgtttccaattttggacatttctgaatatcgacttaaaatgtgcctaaataaattaacgagagataaaagtcagaaaaatatgccacaaaaagtgatttcttcaacagggattttaaaagaaaattttggaaaaattttaccctttttttcacctttttgtaaattttttgagaagtaagtaggttttttttttgagaaattacgaaattcgatggttttgtgtcagttgaagtttttaggcaaaagaacccacaaacacttcccttttgcacataaaattgatcaaactgaacaaatatcattatttcaattaatccaataaaatttcagctaagaagcttgctcatcactcgaatgctcactttgctcaagagtgcctcgttcacttgtgttacaaatactctaggagctattgcaaacctaattgtcaaagatccccacatgcagcaaatgattcggcaggatatggctgcagtacagcaactcaacgtactccgaaactcgaatcgtgatgatattcggacagcagtgaagtctgtgctgaatactcttaatcaaccgtgtagtcatcgttatggtgatatgtcacattctgttggaggaggagccacagggatgcaaatgctttcggagccacaacttcagatgcaaacatctcatcatgcttatcatggaactgcgtcaccaagattactatcactgagagcaactcgagcatcacctggaaaatatatacaaccacaggctcaacaacagttgatacagactccacaagttgatcaaagatctagtagtctgccaagacattttgccgttcaacgaaatggatttgtgatggcacagtcctacaatcaacaaatggatcaacatcagcaacaacaaatgatctatcaattgcagcaacaacaacaaattatggtaacgattttccagcgtttttttctgtaattttctcttagtttcagacggaggatcaagcgcaaatggaacatcatcaacaaatcatgtaccttcagcagcaacaacaacaatttcatcaaattcaacaacagcaacaaatgcaaaaagctcaggaagctgatccagttcctcctacggatgacgatctagatattcccacatctaccgtaatgggaacacgaagtaacagtgaaagaagtctcggctcgatgaatcctggaagtgttatgacaaactggaattcttctctggatactgcagccaacagttctcgtgctctttctcctgtatcatacaatgatattccagcttctccaacaatgtgtgctcaggtgttcaatttacctaaatccactgaatcggaacatcatcaattgacgtctcaacagcagaacactacacattatagcagtggatcagctaacactatgactcggagtgatggtgcaactactgtgccaatggataacattattacaccaacttatgctattttgaatccaatattggtacacgaacagacaccgaacgggacagttccacgaaagacttcagaagagttggatagtcctgatgatgttctcccaggtccatctcttgaggaggaagaaggtgattatgctataataggaggtgccgcacaaaagacagatgacgagcttttgactcgttctattcaatctgaaatgcctacttcgtcgtctactccgaagatgaaagtctcgcctcgccttaatggattcttctctccaactcagaaaacaacatcgtctcctgcatggtctcatccagatacctcaccgattccaaagtcatcttctcatcgaactcaacctaatcgtcgtcaagatgcttctgatgcagatcgtcttttaatggaatcaataatgtcagagatgccaaaaagtcgaattatatctccacgacttgctggtacacaacaatatcttgaacccgagccagagagaagaagtcattcaaaaaacgaggaagccgatcgccgcgacgcattcaccgcatcgcatgagcccagcgatcataacggcattgatgtggcaagaggctcagactggtctccacaacaacaattacatcgaatggagtcattggaaagccaagctagtagtgaagatagttttggattaactgctgaagaaccaaattcatcaacttctggtgctgctgcaaacactatgagatttgacgatgagatcgatgcatctcttccaatggattgtgtcgatgatgatgattacgactatacttatgatcatttcgaagattatgaagatgaggaggatcctgatgcgactcagtttgatgatggagttgatgcacaactaactatcgattgttcaatgatttctagtggaagcggttcatcgcaaagaaatgaaactacgacaacgtcacgagattcaaaagctttagctacttccacaccaaaaggatctgcatcttcactcccaggagttcgacaagccacccgagtatcaacgaatggaaagtcaagactgcctgttccaaaaacgaatggatcacttgttgataaggtatttattctattaaaaaactctgattttatagaattaaacaatgtctcatgaaaattgaaaatcgaaaaaaacgagagaaaattcaaaaaattaatcacaaaattcaattgtatattgatgaaaaaaaatatttaaaaaaaacataacttttgcctaaaaatagtaatatgaccaatatttgagattttttcgaaaacccgaaattgtttttcaatatatcgggaaaaaaaaaacgaaaatgttcgattttagaaaaaaatccaaacttgaaccaacaaaaaatgaaaactggtaaaaactcggcatttggctctagcttcttgcccaagtttagacagcttctgatccaagttaatttttttttgttttattaacgtaaatgagtacagtagaaaaacaaactttaaaaaatatatcagagatatttaacttttgaaaaaaaaaacactaaaaaccataaataaacccacattttgttaaagaatatttgtaaaatatggaaaaatagaaagtgagttttttattaatttttttttagcaaaaaaaaatcaaaaaatgccgagccctgctcccaatttttttaaattaactttgataaaatcaaagaccaactgaattctaaacgtttcaaattagattttcaaacctcgcttttttgcagaatcccaagccaatcatcgcttcccggcggccacgattgccaccgaagccgacacttttaaaagataagcactatccagaagaggattcgattgagaatcagacgagagatgatacgatatatgtgaatgctccagttgttgaggcagaacaagaacgaatttatatgaatgcattgaagcaacagaagaacattgagcaatcaccgtcaattggaaacggatcacctatagctaaatctgcaattgtaacgccctacaattatcagaaaccgcctttcactgtaagaaaataattacttttttttaaaaagtacagtatcaattcaaacatgaagaaatattctttaaaataaacattttcagggtcgaaataatggtgaaatgagcaacgagaagagtgtgacaccgaatcctaaacaaatgcttgtaacaatagtctaatgatccgctcatataccgaaccttgttctttgtatccccgtcatctctagtcgttcccagtttctagtcgagtgttctcatcttcttattctacctcgaacttttatattattgtctaatggaccctgtaatcatatttctagcgctggcaatatactatgttttccaattttctgtaaaatgtgatttggttcttgttcttgtttccattacctgaccgctcaatacatagctgttaatatgtttcattcaatttgtaatacgagttctttcaacctcactctgctccattgttttctcatcttttttgaatcataaata