Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [cgc5603]:yk170f4   

[cgc5603]:yk170f4RNAi[cgc5603]:act-5
Sequence[cgc5603]:yk170f4
Sequence_typecDNA_sequence
Reagent_typecDNA_reagent
Overlaps_GeneT25C8.2 Chunk_score Abs_score1203
Max_abs_score1203T25C8.2
Specificity_index1
Rel_score1
WB_DNA_text[cgc5603]:yk170f41651aggggaaataatacacaagtaccatcaattttactcaattcccaagtagcaagtggtcctaacaagtttattcatgttaagaaaccataaatataaagaaaatgaagtatctcatggaatttgtgtcaagtaaaatcgtgtttcgcctagaaatggaaggcacatgttgaaaaaaaaaatttgaaaaaaaatcagcttagaagcactttcggtgaacaatcgatgggccggactcgtcgtactcctgcttggagatccacatttgctggaaggttgagagggaagcaagaatagatcctccgatccagacggagtacttgcgctctggtggagcaataatcttgatcttcattgtgctgaaaatacaagaattataatctcatgtactgagaaatgtgaagcttaccttggagccaaatgttgaatctccttttgcatacgatcagcgattcctgggaacatggaggtacctccggagagaacagtgttggcgtagagatcctttctgatgtcgacatcgcacttcatgatggattggtaggtggtctcgtggattccggcaccttccattccgatgaaggcaggctggaagaggacttctgggcagcggaatctctcgtttccgatggtgataacctgtccgtcgggaagctcgtagctcttctcgagggaggaggaggaggcggcggcggcgagctcggactcgaagtcgtgggcgacgtagcaaagcttctctttgatgtcccggacgatttcgcgttcggcggtggtggtaaaagtgtaaccgcgctcggtgaggatcttcatcatgtagtcggtcaagtcgcgtccggcaagatcgagacgttggatggcatgtgggagggcatatccctggaagattagaagataagatcggatgtaggttctagatttcttagatcccaaagaattctcacaagaagattgtggatcagataagaagatcagaagctcaggctatgatttgcagagaaatgaggtggccttgctcttactaagttcttacagttccaaaaacttaaaactaaggataagagctgctgagctgaactaaaagtttccgaaagcgctgtgagcctgtttctggctgcaaaaattagtcgaagcagacgtaatctccaaaactttacaccgccaagtcaaagaagattgctgtcttcttatattctctaaacccatctacctacttcatagattggaacggtgtgagtgacaccatctccggtgtccaaaacgattccggtggttcttccggaagcgtacaaggaaagcacagcctgaatgttgacgtacatggctggagtgttgaaggtctcaaacatgatctgtgtcatcttttctctgttgctctttgggttcaatggagcctcggtaaggagaactgggtgttcctctggggcgatacgaagctcgttgtagaatgtgtgatgccagattttctccatatcatcccagttggtgacgattccgtgctcgattgggtacttcaaggtgaggattcctctcttggattgtgcttcatctccgacatacgagtccttctgtcccataccgaccatcactccctgatgacgtgggcgtccgacgatggacgggaagacggcgcgtggagcatcgtctccggcgaatc