Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: [pmid12181365]:PEX13   

[pmid12181365]:PEX13RNAi[pmid12181365]:PEX13
PCR_product[pmid12181365]:PEX13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32A5.6 Source_evidenceePCR844WS150 Sequence/Annotation Release
Overlaps_Gene F32A5.6 Source_evidenceePCR844WS150 Sequence/Annotation Release
Chunk_score Abs_score760
Max_abs_score760F32A5.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII72501717251296
Overlaps_transcriptF32A5.6 Source_evidenceePCR844WS150 Sequence/Annotation Release
WB_DNA_text[pmid12181365]:PEX131126tgaattcaaatctcttgctggaaaagcgttaacaaatgtgtctaaattgctctgttgagtaagtggaggagattgtgattgttttccgacaattctgacgtagttaattggaacaagtccaatacgacttccatcggcaacactaaaatatgaagaattaataaatatctaatcagagagctttttgatgctaccttgctaaaagccatcctctaactctgggttgttcttcttttggagccactcttaacgtttctccattcatgaagctaagctcttgctcatttgaggcttgaaagtcgaaaagtgcttgagcagtataatgtggagcggctccagttgcccattttctcttctcttcagcagcttgtaccatctgactgacacatctatagatgagccatggtcctccaattgcaacaacccagaagagagcagcaggccagttgacacttgctggagttcttgtggcaccaagaacgtctgtggctggaaggaaaattacgattttggaaaattatggtacaagaaataaaccaaaagaatatagattatttcgaaaatgtagtcagaatcattatttatcgtattattcctaattttagatattcaaactatatttctcaattctaaacaaaatttgaacacttaccatacggttgtgatgttccccaagccatttcagcagcgcttgcataacttgctggtttcaatttcaacataaccagtagccatctccagaaacgatatacccatcggaaaactgccaaagaaacaactactgatgacaactggaacaatagaataattattatcagatttgtttttttcaataaaaaactcacctgcgtctttaatcttccaaattgctctacaactccaataactgctcgaaaagaactataaactgcattatgagttgaattgagcatgttggcgacagatgagactgcatttacaactgattcgattgattgaaaagcgcctcgagactgttcttctgcaagtcgagcaaaattgctgtcaggtccttgaccatatcccatatggttgaagccaccaccaaatccaccgtaacccattcctcctccatacattcccccaccaccatacctaaacaatatac