Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:10-a12   

Cenix:10-a12RNAiCenix:10-a12
PCR_productcenix:10-a12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C47E12.2 Source_evidenceePCR544WS150 Sequence/Annotation Release
Chunk_score Abs_score460
Max_abs_score460C47E12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1000211510002801
Overlaps_transcript C47E12.2.1 Source_evidenceePCR544WS150 Sequence/Annotation Release
C47E12.2.2 Source_evidenceePCR544WS150 Sequence/Annotation Release
WB_DNA_textTH:10-a12687gtttcggtccaattttgctcgatcacatatgcttgtgaatctcttcgtaaagtgccatgacaagtgctccaccagcgcttctgaaaccataaatttaaagaacattatatgtaatcctcatacaaacctaaaaatgttagctaacgctcctttgtacaatccgcgaacaccttcctcatggacaatttttcgtgcagctgaaaaagcctttgatgtgctcagctgtccttttaccatcattcgccgccgcacagtgtcccaagggtaggttaaatatgacgatagtacggttacaccctaaaacagtttttaatgcaaataaagtttttgaaaaaagaaaacatacttgtgcaatggcaaacgaagcataaaatggtaatttcttcttatccgtgtttatagtatttctgatagcgtcgtataatccgaaatatacagatctataaatgaagtatgtctgtaaaaatttttaataggacgaagataagaaagatacattctcacttgaagagaaatagcgaatcctctgtagagtgcactaaatccttcatttttcacggttttcattgtgcaatccacaagacctttatattctcgcttcgtgtgatgattgatatcagcagataaccttgtacgaatgaaatctaatggatacacaatgcaaagtgaagagcaaccagcaagtcc