Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:10-a7   

Cenix:10-a7RNAiCenix:10-a7
PCR_productcenix:10-a7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST13F2.7 Source_evidenceePCR563WS150 Sequence/Annotation Release
Overlaps_Gene T13F2.7 Source_evidenceePCR563WS150 Sequence/Annotation Release
Chunk_score Abs_score542
Max_abs_score542T13F2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV97752339775795
Overlaps_transcriptT13F2.7 Source_evidenceePCR563WS150 Sequence/Annotation Release
WB_DNA_textTH:10-a7563aggcccatcgaaatcttcttcagaagatgatgatgttgaatccgaagagtctgatgtagctggctttttctttttgcttttactcgcttgctgtttctcttcatctgaatctatttcaccttcatcaagaatacgtttaacagctgcaagagtcggagaaggttccactgtttctattgcaacttccgaatttccatttacagcggtttcattatcaatttctccttcatcaattatcgctcctcttgccataattctctgtttaatatcggcttttcggtttgaactcttctcatttctccatttcttccattcttcttgactcattccttcgacaattctcgcctgtctcatttgtttcttcgataatccaccatttccaatcttctttgaaccatcatcgttggctcgaacaactccacttgccttggtttttgttatacgagcccacgaatcaaagcttaacgcttcaccaccgatagtaacatttccatcatcatctgaatccatatcaacatctcctgtttcgacgatgaggcgatcacgattcgcgttaaggaatg