Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:10-f12   

Cenix:10-f12RNAiCenix:10-f12
PCR_productcenix:10-f12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C52E4.4 Source_evidenceePCR514WS150 Sequence/Annotation Release
Chunk_score Abs_score451
Max_abs_score451C52E4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1198423011984835
Overlaps_transcript C52E4.4.1 Source_evidenceePCR514WS150 Sequence/Annotation Release
C52E4.4.2 Source_evidenceePCR514WS150 Sequence/Annotation Release
C52E4.4.3 Source_evidenceePCR514WS150 Sequence/Annotation Release
WB_DNA_textTH:10-f12606gattaacgtaacgctcgggatgaagaagtggagtctcgacaacttctcgaagcttttcaatttgatccttgcagcctccgacatccgaatatgttacatctggtttttcttcaacctgcatcattgtgacggttggatcaattttggcgggcaacggaagatgaatttgatacttgttacggtctactcctactctcatgccctcctgaatcatttttcaattatgtgtgaaatctaattacaatttcaaacctcaatatcagtaggtgcaacggaatcagcaaggtctacaacaaacttagcgaactgttttacgttgatcaagtaacgcggatcgtgcttgtcgctggtgataatttttgtgcatctggcaacttggagaggctgttcttgctgcattgcttgtttatcagcagcaatatcccatagagctggtggagccaacccggtgtctgattctttcactccagaaagttcgttcacctgtagaacaatgaaataaaattaggagcacgatgaaataaataccttcttcagacagttttcaatatccgcgtccaatgttttgagctgttccgcgtatggaccttgcccgtatcttttcaa