Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:10-g11   

Cenix:10-g11RNAiCenix:10-g11
PCR_productcenix:10-g11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C41G7.2 Source_evidenceePCR587WS150 Sequence/Annotation Release
Chunk_score Abs_score545
Max_abs_score545C41G7.2
Specificity_index0.876
Rel_score1
Map_statusUnique_ePCRI95130229513656
M01E11.6 Chunk_score Abs_score77
Specificity_index0.124
Rel_score0.141
Overlaps_transcript (2)
WB_DNA_textTH:10-g11635ctgcgactttttccctgaagccgtcggtagcaagagcccgaccagtggcacagaagcctattctcccttccaaagtgacgcttcttgaggagagaaatgcgcaattggagcgtgagatggctgaggctaccgactttgccgaacatcaaaagagcaagatccaattcctggatggcaaacttgaaggcgcggatcgcaagctgatttcactgcaagaccaattgagcacgctgaaagaagtccacaagtcaaaaatggaggagtgtgaggagtatcgtgttcacaacaacgatctccgggatctgctcaacgaaaaggaagctgagttgagaaagttgcacaacgatgtcgtcgatttacgcggtcaaattcgtgtagctgttcgcgttcgaccgttgatcaaatctgaagtcgacacctcgagttctgcgattgagtatccagctgtcgatgccatcaaaatcaatgaaggctcgaagcctggaaatgttgtcaaattcgagaatgttttcacaccagtcttctcgcagaaggaagtattcgcgaacgtcgaggagttcattcgggttagtttcaaaatataatattaataataaaaatgttgataatttcagtcgtcactgcatgggtacaac