Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:100-d11   

Cenix:100-d11RNAiCenix:100-d11
PCR_productcenix:100-d11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK08D12.3b Source_evidenceePCR129WS150 Sequence/Annotation Release
Overlaps_Gene K08D12.3 Source_evidenceePCR465WS150 Sequence/Annotation Release
Chunk_score Abs_score361
Max_abs_score361K08D12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV17101241710920
Overlaps_transcript K08D12.3a.2 Source_evidenceePCR458WS150 Sequence/Annotation Release
K08D12.3b Source_evidenceePCR376WS150 Sequence/Annotation Release
K08D12.3a.1 Source_evidenceePCR465WS150 Sequence/Annotation Release
WB_DNA_textTH:100-d11797tttctcgccctcactgtcttggatttttgtttctctgaattttcgccatttttgattgaaattgtgacattcaaccgtttatttttttgtaattcctcgcaactgataatttcttttttctaaaatcaattatttgcagtaatgtcggacagaaattgctacaagtgccaacagccgggacatatctcccgcaactgcccgaatggcgagtccgatggtggacgtagaggaggtggaggaggtggagtggtgttgaatttggggtgttgagttgatttaggtaaatacattatctcttgatttcttaccgaattgcaataatttttgaagttctggagaagtggaggcgaagagaaatgtgtttaagctggcggagattaggagttatttgatgataaatttacagcggaaatctcgagactaatttcatgttatttcaggatccacctgctacaactgccaagagactggacacttctctcgcgattgccccaagggaggatccggaggaggacaacgtggaggtggcggcggcggtggatcgtgctacaactgcggaggacgtggacactactctcgtgactgcccatccgccagatctgagggaggaagcggtggctacggaggccgcggtggagaaggcagaagcttcggcggacaaaagtgctacaattgcggacgctccgggcacatttcccgcgagtgcaccgagagtggctcggccgaggagaagcgttgctaccagtgccaggagaccggacacatctcccgcgactgcccaagccagaccaactaaa