Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:101-d6   

Cenix:101-d6RNAiCenix:101-d6
PCR_productcenix:101-d6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST15B7.15 Source_evidenceePCR609WS150 Sequence/Annotation Release
Overlaps_Gene T15B7.15 Source_evidenceePCR609WS150 Sequence/Annotation Release
Chunk_score Abs_score525
Max_abs_score525T15B7.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV68393536840141
Overlaps_transcriptT15B7.15 Source_evidenceePCR609WS150 Sequence/Annotation Release
WB_DNA_textTH:101-d6789gcaagatgagcaaacacagcatttcgattctcttttataacttcgtctagaagaccttcttcactggatagaacatcctgaaataaagagaaaaaataatggaataagttgttttgaattaccttaaagaatactttgagttcttcaattttcttattttgagccttgtgagaatcaattgtcgctttccttgtctgttgttctctcagaagctgatcttcaagaagtgacgtcattttttggcacttgtctgagttttgaagagcttcgtctagctataagttattattttgctatatttatttcaaaagtttcaacacttactttactattcaattcattctcaatttgaatatatttctcgagagtagtttttcgtttattctccgattcttccagtcgtctcttactatctttcaatgccttttcagtctggaaaagactaaataaaaaagttaggaaggaaataactcacagtctggccactcttttccaaaagactccgtaattttaaattctcttcttcacgttcctgagtttttcctatttcttgcgtcaattcggattgtttctcctcgagcatttgctccattcgtaacatatcttgcttctttctggtaagttctaattccaaatgttcaattacttgattattcatcagagtgtgacctttgctctccagacttgcttcaatacggatctcagcaacagcttgctcgaactcggcgctcaaatctgcacgagctctggaattttcatttaattctctagatgatttgcgacgtgaca