Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:104-h10   

Cenix:104-h10RNAiCenix:104-h10
PCR_productcenix:104-h10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10G3.6 Source_evidenceePCR291WS150 Sequence/Annotation Release
Overlaps_Gene T10G3.6 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1350045413501336
Overlaps_transcriptT10G3.6 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textTH:104-h10883ctcggatatgaggctgttccgcttaaatgtaatttaaattaatggtttaggtatgtagaaagtcccgaatttttgttgtaactcacgaaatattactatttcagctgttcttctcattcttcaaatcactcgtaggaaaggacgttgtcgtggagctcaaaaatgatttgaggtgcggtttgttaaatcagtatatacaatttacagaaaatcgagaaaataactggaacccatgtaaaacttcaatttcaagacatttcttaaaaattggttcacaaaaaatgcttaaaacttcttgggttcaatattctgaatgtctagaaagaattcgaaactccccgaaaatatgtattagccagacggaaatcattttcaacgatacacttccacataatgaaaattccgaatttctcgaaatctctttaaacgcaagtgccattcctgggtttgaatttaaattatgaaattccatttaagattagttctgctaatttttataagttttgaagtttaaatctcacaaaattaatatttaaaaaataattatcttattctaatctctcaaatgcaaattctaataatttttcagtatctgcggaactctgcactcggtcgatcagtatctcaacatgaagttgaccgatatcaccgtctccgatccagaacgatttccacatatggtctctgtcaaaaactgcttcatccgcggatccgtcgtcaggtacaattagttatcatttttcataaatatttcaaaatgattctttaaaggtacgtgcaactcccatccgatcaagtcgacacacaactcttggctgactcctgccggaaggagcttctcgattcaaaggcaaaacagtaaatccacgtgttcattcctcaa