Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:105-b11   

Cenix:105-b11RNAiCenix:105-b11
PCR_productcenix:105-b11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T27B1.2 Source_evidenceePCR524WS150 Sequence/Annotation Release
Chunk_score Abs_score461
Max_abs_score461T27B1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1653846916539267
Overlaps_transcript T27B1.2.2 Source_evidenceePCR524WS150 Sequence/Annotation Release
T27B1.2.1 Source_evidenceePCR524WS150 Sequence/Annotation Release
WB_DNA_textTH:105-b11799ccaagctccttggcaactacattaagtcaagtgcatctgggagctgttcagccgttgcatgccagtgctttagtacctccaagtgatcatcaaatcgatttggacactacctctcttgattcattgatgcagagtcagaatcaaaatttccttatgcaactttatgggttagtacttttagacatttatgataaatattatacattaactaatttttacaaatatctctattacttttccaattcaacatttgagttattacataatatctattgaaatatctggttagagttaaaaattattgaaagtcagtttaatactgaaaaatctctaaaatcataattttcagctatagcgacgatggtcgccacaacggaggcatgctgtcgctggacgacacgatgctctcaaatctcagtgattctaaatcagactctggctcatcatcgggtggattgagcattcaacttccaatgcaaactattaacatgcttaacttccggaatcttggcacgcaacaattggtacgtttttgtttttatggttttattttggaagttccataatgtctccccaaaccaaataatcacacaagtttcgaaaacattttttttcagccgccagtgcaccaactcgcctcctccttgccttcagtgtcatctggaatggattatgtaaatgtaaaccagcatgactctcactacatcgtctcccaacccgacatgatgctcggaaaccagcccctctaccacaatggaagcttcgccaacattgaaaagagcaacccacacaacaatca