Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:106-h6   

Cenix:106-h6RNAiCenix:106-h6
PCR_productcenix:106-h6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC08F1.3 Source_evidenceePCR748WS150 Sequence/Annotation Release
Overlaps_Gene C08F1.3 Source_evidenceePCR748WS150 Sequence/Annotation Release
Chunk_score Abs_score713
Max_abs_score713C08F1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII17892471790046
Overlaps_transcriptC08F1.3 Source_evidenceePCR748WS150 Sequence/Annotation Release
WB_DNA_textTH:106-h6800gtccctattgcacggtgagtacttatttatcatttctagatttcaaatcaattttcaagttttcagatttgggttctcattgctctcaaataaagcaaaacgtctcataattaatctccaagaattcagccactttgtttctattgaagtgcaaaatcgtatcagattaaaattgagcaggctacatttcattattggagggcccgatggtctcgtgaatattgtgtatatttatattcatagcagaactgttaatgccaaatggagcctgccaggaatgtcaactagacagtggatcgatcactttatggagttgacaaatagtcatcgaatttttaaactgagcatcgatgcaaaaaacccagagattgatatgaaagacttacacagagctctaacagggttgcgagtttccagattttttctcaatggattctacttgccagatattcaattatttggctcacttccaactgtggatagcatgttgttcggtctccaccttactcaaacaactaattatcaacgaattatgcttcaaaatcatatccagttcacagatcttcggagggatggagcacgagctgatctgaacagtttgttagcgtcaaatgcatcatccatacaatttccaaacatgatcttatcggatgctcaactcaatttgtttcttaaacattggatagccggatcgaatcaaagacttgacttccttaaaattttaaaaattcgaaacgtgacagtcgacgacgaagaggtgattttcaaaggaattgatcgtcaaccagcagtggacagag