Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:11-d1   

Cenix:11-d1RNAiCenix:11-d1
PCR_productcenix:11-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F23B12.8 (3)
Overlaps_transcript F23B12.8.2 Source_evidenceePCR535WS150 Sequence/Annotation Release
F23B12.8.1 Source_evidenceePCR535WS150 Sequence/Annotation Release
WB_DNA_textTH:11-d1580aatgccttcatggaatcagccatcgaagaacaggcagctctcacatgctccacattcttcttactttcattcgttcgtgcttcgtagctatcacatgtggtttgatggagagtagataccaatggtttcatatcttctgtgaagtcggatacttgtttcttcacctcatccaatttgtcaactaccatctgagtgaattcttgagatttggccgagtatgacttgtaaaaatcatcacacgtcttcatgactgtttccaatctgattcgattttccatcgatatggcagtcatgttgtcgatgactttcttctccgcttccgacgatttcttcattatgcatatggcatgtgtctccatatccattgccgtactctcaatgtctcgatgagcagattccattgatttgacatgagggcaaatattttccgacaacttctttgataacagatcaccatcagctttcagcgagttcgtcagctttgaggtcgtgtcgatgaaatcactcatctgaaaaaaaacatctaactaagaatgagataatcctaatattacctttttcgagaagtggtcaatgacga