Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:11-f1   

Cenix:11-f1RNAiCenix:11-f1
PCR_productcenix:11-f1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F28D1.1 Source_evidenceePCR529WS150 Sequence/Annotation Release
Chunk_score Abs_score487
Max_abs_score487F28D1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1237230412372879
Overlaps_transcript F28D1.1.1 Source_evidenceePCR529WS150 Sequence/Annotation Release
F28D1.1.2 Source_evidenceePCR529WS150 Sequence/Annotation Release
WB_DNA_textTH:11-f1576gggtgtggaggagaaaatgagctggaaagagtataaaaagatgaagcagcatactggcggtggaacacgaaataagttaaagaagaagcagaggcctccaactgagaatacagaaggaagagctaaaaagccaaaagtgttaacaaaagagcagcttgaacgacatgatacaggagcagaccaaattgatccatcttcgatgcgttcaaagcttcaacaggaaaaaatgaaagtgacgaaggacaagtttcagagaagaattgaagctaccgctaaagccgagaaacgtcttgttgaaaatgtgagttgttccattgctactcaaatattcacaaaatataatttcagaccggattcgtagcccccgacgaggaggatcactcgctgacctacagcatccgacagaaagatatcgctgaatcagttgatttggctgcagccacaaaacatttcgagttgaaattgccacgattcggaccatatcacattgattatacggataatggaaggcatttagtgattggaggacgaaaaggacatttggcagcacttgattggcaaaccaagcatcttcat