Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:11-h10   

Cenix:11-h10RNAiCenix:11-h10
PCR_productcenix:11-h10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T25G3.2 Source_evidenceePCR5WS150 Sequence/Annotation Release
T25G3.3 Source_evidenceePCR660WS150 Sequence/Annotation Release
Chunk_score Abs_score598
Max_abs_score598T25G3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI75598447560664
Overlaps_transcript T25G3.3.2 Source_evidenceePCR660WS150 Sequence/Annotation Release
T25G3.2.2 Source_evidenceePCR5WS150 Sequence/Annotation Release
T25G3.3.1 Source_evidenceePCR660WS150 Sequence/Annotation Release
WB_DNA_textTH:11-h10821tccctggacataaaaccgacagttggtctaatcgcttgctgcgaatgcggtgttgcgattgaaccaaatccagcgaatatgtgcagtggatgccttcgctcgagggtagatattaccgagggaatcactcggcaatgtgagttttctaaaattgttgaaataataatttttcaaatttcaggcacaatttacatgtgcaaattttgtgatcgttactttgttccaccaagtgcatggatgagagcagaactggaatccaaagaacttctttcgatttgcttgaaaaagttgaagccaatgctaacgaaagtaaatcattcacggaatcacttcagttttcaataaaatccaaaatttaggttcgtctgaccgatgcgtgctttgtatggacagaagctcactccaagcgtatcaaagtgaaaatcacaattcaaaaggaagtattcactaatacaatcctacaacaagctgtcgtcgttgagtttaccgttcacagtcaattgtgcgatgattgtcgtcgtgctgaagccaaagatttctggcgtgcttgtgtgcaagttcgtcaacgtgcagagttcaagaagactcttttctatttggaacaacttctcctcaaacactccgctcacaaagaatgtactggagtcaagcctgttccgactggaattgatttttactttgcgaaacaacaagaagcgagaaaatttgtcgactttttgatgactgtacttccatgcaaatatcactacgcgcaggtttgtgaaagtcgatgatgctgaaataattgacatcagtttgcctacaaatcaggggtgcatagc