Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:113-b4   

Cenix:113-b4RNAiCenix:113-b4
PCR_productcenix:113-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY2H9A.4 Source_evidenceePCR787WS150 Sequence/Annotation Release
Overlaps_Gene Y2H9A.4 Source_evidenceePCR787WS150 Sequence/Annotation Release
Chunk_score Abs_score702
Max_abs_score702Y2H9A.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1344825413449949
Overlaps_transcriptY2H9A.4 Source_evidenceePCR787WS150 Sequence/Annotation Release
WB_DNA_textTH:113-b41696tcaatgccaccgatatgaaaaatgtttgaatttttctctcttctatttctctcattttcttgttgttttgtgaactccgatgtattcagataactgggaacatacgcacttccttatgctttttttctgagttgataagattgaacaattgaatacattctccatgtccttttgtttgctacgcgagcatcacaactgtttgataatttataattttcacacagctttaattatagcatggttttattgatcattttccctcgtaaaacaattgagaagttgaaaaccttgcttgaactagtaggttttccaattgtcccaaataacggccattttctttcaggagattgcaaaaatgtccactttagattcgaatactaatttcgtgagttgtgcgtttcgaacattgcgttttatatgtgataattacagtttccagcgcttgctcaaaccattttgtttacttttccctttttcaatcttgtaagagatgacctaccaatagaagagacacaagtgataagagagtacgatttgatattggtaaatagctattttataactttaccatttaactttcgttactcagaattctccaaataatttcgaacatcatccgcttttcttccaatttcacagtgaactattagattcggattcaataggcagaagtacgtactttaatagacttttgctagaagaggtcagtagttttatttattgcgttaaaaaaatcaaatttcctttttttcagcgccgcctgccattcacgaacagtattgcattgcttccaatgttctcattcattccctactctataaaacataacttgtcccgcctcccttttctgtcgaatgtgactcagtacctttccaaaattttccgttgttgtgtaatcaaaccatttgttttttcattcttggttgttgctggagttttgtcgttctacctattccttgcgatgtcatgctttggtgcctgtaggagcggattcatcaaatttatatgtcttccaatcacacttttcaaactgatcttctacaaccagaaagggtatataccgtgagatattttttgttggaaaaataatctgattgaaacacaagaaaatatcatattttcagtattattcttgcactcctcttgctgtaaacagttaaacaaaaaagataatataacgagtcacttttttgataaagtttatgacgttctctacaagggcagcaatgaggaagattgttgtcacaaaacagatagggactgaccaaccaaactttcaaataactatcaatttatattcaaaaaggctaattatatctgaaaattctgtagtttctgaaaaatcttttcacatttgaaactaatttctcaaaatttcaaaagtagtttttgaatatatacatacatttttttccgttcaacatctattttacagaattccaagtagtgatcctgagaaccctccagatggaatttcgaacgggcacacacataactttagtggctcaactgatggaaaacatcacggactgtccccaaaacacatatctagtattaactatgatattgaaaaagcagaaaatgaaaagataaagactaacgaaaaaaatgtgcaaatttatcctgccaattccaaattcaaaacttgctctgacgaaaaactagataaaagtcgaagaaggtcattgcaaatcgg