Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:114-h11   

Cenix:114-h11RNAiCenix:114-h11
PCR_productcenix:114-h11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC47E8.2 Source_evidenceePCR958WS150 Sequence/Annotation Release
Overlaps_Gene C47E8.2 Source_evidenceePCR958WS150 Sequence/Annotation Release
Chunk_score Abs_score852
Max_abs_score852C47E8.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1466382414665483
Overlaps_transcriptC47E8.2 Source_evidenceePCR958WS150 Sequence/Annotation Release
WB_DNA_textTH:114-h111660ttgtgagcttttcatgccagacaccaacttttctccaacacatttttttgatctagacttttttactcaatatggattgtgctgaaactgatcataatgaatactattggattatgcatggcattttcattgtatctcttccaatatattcgattgcaataattgcccttttgcaaacaaaatctccgtattttgaaaaatataaattgtttttgatttggcacacttccacgtaagttggaaaatgccattaaatactcaagtttcaattaattcaggaatttgttagccgagttgttaaactcctggtttttgattccagttgttcatgtgaatcttcctattttaagatttactggaattctgtcacattggggattttcaggattatttcagtttttcgtaattggcactatgatatactgtaagttgagtagaagaggttctgaagcacttcttattattttttatttttcaatggattttcaccgctaatgtaaatgcttaaaacctcaaaatgtatagaatgtttaaaaacctcaaaattttgaatttcagtgaccgcatactctgtacttgaaatgtttatgttccgtttccgtgcaagtttattcaactataaatcaacatatttttatatctacttaaaagctaatatatatctcttccgattcgcaatgttatgttttttaactttgaatatttgtacctacagttttgcaatcgatcaacagactgtgaacaaatacagtttatcattgaagtttcccgatgcaccttcaattatactatgctatactgtcattgcatcagctccatttgctgatcctgcgacaatgttcaatgttttgatatggttgagtgtggtgattgtaaccttgacatctacaattgcaactacagtataccttcagaggaatctgagagagaatgagcattattcggaaactgttgtgagaatgcacaaaatgcttttgattacattatccattcaggtaaatttagttttagctagttttgaaattaatatcacaaaaaattatttggatcaatttcaaatcgataggtgcacaataatttagaattctgattgacaaaatagcgtttaataagatccaaaaatattctgaaaaaaaagaagagtagccaaatgaatagtttgtttccgatcgctgtaagtcgggaaaatttgtgacaatagatttagacatatgtaatttatttttgaaatttcgaacagcctaaagtgtgtttagaaaaaaaaattcgagctttagaaaccatttttcaaagcaatacagacaactacgaaaagattgtcaccttttgtcctaattttcaacattaaactgacttattttcacacaataataacccccaataaacatgagtttaatttccagactgcaattcacggaatcatgttaggaattccaaatgcattattcatttttgccgcattttttggagttcgccatgaatgtaatatcaccttttccaaattcgaaataactagatgtttcagctgttgcaaaactttcattcatttttctaacaactcatggattagcttcaactattgcaatggtcgtgctcacaaaaccaatcaaaattgctgctatggaactttttaaatgcagaagtggcgataaagtggtgg