Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:116-d1   

Cenix:116-d1RNAiCenix:116-d1
PCR_productcenix:116-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K11H12.2 Source_evidenceePCR537WS150 Sequence/Annotation Release
Chunk_score Abs_score474
Max_abs_score474K11H12.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV653548654503
Overlaps_transcript K11H12.2.4 Source_evidenceePCR537WS150 Sequence/Annotation Release
K11H12.2.2 Source_evidenceePCR537WS150 Sequence/Annotation Release
K11H12.2.1 Source_evidenceePCR537WS150 Sequence/Annotation Release
K11H12.2.3 Source_evidenceePCR537WS150 Sequence/Annotation Release
WB_DNA_textTH:116-d1956cggtggaaaactttggtgttctttctcttccagttcttggcttgggatcctccgcgggtagcagagaaacgccatccctttccgagtccacgagacttgcgtccagcagaggtgagtcctctttgctcacggtgcttgtgaactggcttggtgatccattgggtgtctgggttacgacggatagccttgtggaatggatcgatcaggacaacctcgtagaacttgtaggtggagtcctcagcaacccagtaggagttgagaacacggagggatccaagacgacgtccagcgcggccctgaaatacaacgaattaactttgaaaagtaaatgctaatatctgaaaattttgtttaaattgtcacaatgtcatgaatccaatacaccacaaggtgttcggggattacacaatgtttttctatagccatcagtggattaagtcagtactattaaaaacagtctgctttgcccagacactgaggcaacaatttcatctaatcatttaattcgtagtaatcacctcagcaacggcttgcttagacttggcgttcttgagctcgttaactccatgggtctttggctttccgtaggtttgtcccttgcagactggacgctttctgtttcctctgcggacacggacgcggtagacaacgaatcctgaaaaatgaaatttaatctcaataaattgtatcaatgatatgaaactggaaagttctatataactcaacagggattactcaatgaattttatatagccatcaatggattaggttgctcaagcgggtgcagggcaccttgcccagacattgtggcaagtagcttttaaaattttattcaaatctttacaatcttaccttgcttggcacggtatccgagacggcgagccttctctggtctggttgggcgtgggacacggtggacggcgctcaactgtctgtagtgccaggtacgaatacgg