Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:117-c3   

Cenix:117-c3RNAiCenix:117-c3
PCR_productcenix:117-c3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC06E7.4 Source_evidenceePCR494WS150 Sequence/Annotation Release
Overlaps_Gene C06E7.4 Source_evidenceePCR494WS150 Sequence/Annotation Release
Chunk_score Abs_score473
Max_abs_score473C06E7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV58590285860727
Overlaps_transcriptC06E7.4 Source_evidenceePCR494WS150 Sequence/Annotation Release
WB_DNA_textTH:117-c31700gcctggtttgcaaaaagaaaacagggaaacagtaataaatttacgaatctgttccagtctaaaaatgagaactttatagtctattgcacaatacttctacataagaaatctttgcagaaattttttaatttcagtctaaaaaagtatcgacccataaatcgatatgagttacagtaactcgttgtcagcgtgacaaaaattatcattattagacgaaatatgggaaaatatttgatcgattcaaaaataagatttatttctgtcaaaaaacccggaaagtgccagaaaggtttttcagatttttttctaacttttaaacaaaaataaatactattttccaactcgtcaattttttcttgatccttttatagcagcaaagttaactgtgtagatgatttgatatttacaagagaaaatattgaaacagtaaccaaactaacctgtgtaaatcatcatagcttatagctctggagtacattggatgcattggtggtggtggtggaacaggcatctgaatcggaattcctcttgctcccaatttcttcattaatttctgatgcttcttctccatcttctccaatttcttcaatgtctttgcatcaggaggtatcaatatcctaggtggaggcatcattgctggttcgaaatcaatttgattcaatgacattcttgatcctctcatttgtcgtaacctttcagaatcagggcctcccatgtatccagaatctgcattcagagagatcattgatcgtctcatttgagcttttgattgtggatgatgtggattgtgatgcatataaggttcagcgaatgctcctggagcaattggtctttgttttgcttctggatatggagaagtagttgttgaataggatgtcctttgatgcatccaatgcggaggaggcgggtagtgtgacgagcttcggtttcccatctaaaaattattttttgaattgaaaaaaatagattcgagaggaaaattagaatcgtcgaaaatattgtccagaaaaaattaatttttttaaaaaatttactgtttcatgataactttgaaataaatacaacacgtaggaactgttagatgtgctaaatagaatgaaataacaaaaaacgtaactttcaaaaaaaaaacaattaatatttggaagcagaaactattctcacaacattgatgaaacagaaaaaaaaagtttgaatttttaaaaagttatgacttaccaaaaaaatacaaacataaatttcaaattatgtaacatgaaacaactactgattccgaaaaaaaaatccattttttgatgaaatttaaaaaatttaagaaagctttttgattaatcttcggtatgtacctttacaaataaatcagaggtgataaaacagtcctatgaaaacacaactattgttgatattacccaagggataaatgcatagagtgaaacggcacaaacaaactgagaaaatacgggtcttaaactattttttacagagctgaagctattgaggtgtagaaacatgagaagtctagaaatctaggatacatggtggcagtgaaaatagaacgcgaaaagttaaataattaaaataccaaaaagtttggggatagtgttccagaatttggaatctttttcatctttataaataacaaaagaaaaaaaagaaggcgatttcattggtaaaaaaggaggtatgaatggtgaggcgtc