Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:12-b5   

Cenix:12-b5RNAiCenix:12-b5
PCR_productcenix:12-b5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC27D9.1 Source_evidenceePCR590WS150 Sequence/Annotation Release
Overlaps_Gene C27D9.1 Source_evidenceePCR590WS150 Sequence/Annotation Release
Chunk_score Abs_score569
Max_abs_score569C27D9.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII47543664754955
Overlaps_transcriptC27D9.1 Source_evidenceePCR590WS150 Sequence/Annotation Release
WB_DNA_textTH:12-b5590gcattcagtcgtctcaccaaaatgattacccaagatgttaactgtgatcaactggatcttgtgttctctgacagatgtatgtggtcaaagggtacattggctcatcctcgagaggttattgacaggattgtcaaagcttggcgtgttaaatcaatcaatatccgtttcatgacggaatactcttcaatcgatcatgagatgtggtcgaataaaaggatcttcacagaaatgcgattcgatgagatgtttgtgacggatcacaatattataagacctcgtcacgagcgggatcacttcgaacgcgtcgaagtggacatgcaggccggcgatgagattgccacgtgttttgcggaatcgatgggaatgttcgagcagagtgggatgtcggcaactgcatttcagaacgtttgcgccaacgtcaagcgtattttcccaacgcaagatatgtacctcattctgccgactgaactggctcacgtggcttctgtcgagtttgacggtttctgtaaggcacttctggagtttgcgtggaaggatgagaggactgctagacactcgagactcttcttccggctttacacattcggaat