Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:12-b6   

Cenix:12-b6RNAiCenix:12-b6
PCR_productcenix:12-b6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS C33H5.4a Source_evidenceePCR506WS150 Sequence/Annotation Release
C33H5.4b Source_evidenceePCR506WS150 Sequence/Annotation Release
Overlaps_Gene C33H5.4 Source_evidenceePCR577WS150 Sequence/Annotation Release
Chunk_score Abs_score535
Max_abs_score535C33H5.4
Specificity_index0.711
Rel_score1
Map_statusUnique_ePCRIV77970287797726
C06G3.2 Chunk_score Abs_score189
Specificity_index0.289
Rel_score0.407
Overlaps_transcript C33H5.4b Source_evidenceePCR506WS150 Sequence/Annotation Release
C33H5.4a Source_evidenceePCR577WS150 Sequence/Annotation Release
WB_DNA_textTH:12-b6699taaattagcgatgcccgaagttctttaaatttttaaaatctagtcaatagtactattttcttcttcgtgttattgatgatttattttccttctttaattattcgcccgtttactactatttaagctttcaaatctctcattttcagaatgtcgcagtacatcaagtgctacggcagggtacgcccgtcggcacggcttggagcatcttccgaatctctcgttgtgggaggacgcgttgttacgattgatactgataatggatccaaaagatatgagcttcatcatatctttgatagctcttcatcacaagaggacgtctttggaacagtcgcgaagaagattgtcgaggattgtgtggaaggctataatgggaccgtgttcgcctacggacagacagggtaagtgcttccagtttagtttgagaaatgaaagttcgattttcagatctggaaaaacccatacaatgcttggtccctgcgattcatggactgacccagaacttatggggctcattcctcgatcagtggaacacgttttccagcatctggacacgaaggctaaaaagtgtcaaaagttgacgttctccgtttctgttgagtttgttgaactctacaacgaagtcatctacgaccttctcaatgcgaagaacaaagttcaactcagagattcgggaaaagacattcagcttgttggagcgtt