Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:12-c2   

Cenix:12-c2RNAiCenix:12-c2
PCR_productcenix:12-c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC01G5.2 Source_evidenceePCR530WS150 Sequence/Annotation Release
Overlaps_Gene C01G5.2 Source_evidenceePCR530WS150 Sequence/Annotation Release
Chunk_score Abs_score488
Max_abs_score488C01G5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV65283476528923
Overlaps_transcriptC01G5.2 Source_evidenceePCR530WS150 Sequence/Annotation Release
WB_DNA_textTH:12-c2577tccagttggtcatgttggaaccacgataaatgccacattccttgacaccgcgagcccactctgcttgctttccttcgtattgtctctttccttggagaggttcagacttcaatactctagcttgaacattcgcaagatcttgtccgagagaaatcccccagtactggaagcactccatcatcgtttggttttgactcaacttggtaatcagttttcttgtctcgtcaagtctttgctgtggagacatacgagtgtgctttgcaatttccttcatcatcttgaagtccttgcgcatctcatccgtcagtccagtcgggaagcacaattcaggaacgatataattgacctgtggaggctctcctggttgctttggttttccttcggagatctgaaaccgagaaatattctcaattcataataaaaacaaaaagttacgatgatgaattgctcgtcatcggtgatatcaatatcgtattgattcttgaagtactcttttaggatgatttgttctccatctttctggaatttactgagaggggtgatttcgttatcgagcctagtgaaacggtgcagcttg