Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:12-d8   

Cenix:12-d8RNAiCenix:12-d8
PCR_productcenix:12-d8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF11A10.7 Source_evidenceePCR540WS150 Sequence/Annotation Release
Overlaps_Gene F11A10.7 Source_evidenceePCR540WS150 Sequence/Annotation Release
Chunk_score Abs_score519
Max_abs_score519F11A10.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1208580212086341
Overlaps_transcriptF11A10.7 Source_evidenceePCR540WS150 Sequence/Annotation Release
WB_DNA_textTH:12-d8540cagctgctgaaaatgctctgactgtttttgttggaaatatgccattgacaatgaacgagaaatcagtccgtcgaattttctccgactttggaactatttcctctgtccgtatgagaaatctgcttcctgcgaatgagaaattgacgaaacgagtcactcatttgacaggaaaattgaatgacaaacagagttctctcacgttctatgtgaaattcggagcagaagaatcagtggagaaagctctgaagtacaatggaaccaagctggacgatcatgtgattcgtgttgacaaagttggaagtaagaagaaagaatttggaaaggatatggccatttttgttggaaacttgccgttcgagattaccgaagatgctctcattacttttttctctgcacaaatcggacctgtcgaggctgtcagaattgtcagagataaagatactggaaagggaaaaggattcgcgtttgtcaatttcaaacaagattcttctgtgagtcttgcattgagcatggagactatcaaaatggaaaaacgcgact