Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:12-g5   

Cenix:12-g5RNAiCenix:12-g5
PCR_productcenix:12-g5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC32F10.5 Source_evidenceePCR502WS150 Sequence/Annotation Release
Overlaps_Gene C32F10.5 Source_evidenceePCR502WS150 Sequence/Annotation Release
Chunk_score Abs_score481
Max_abs_score481C32F10.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI58161565816657
Overlaps_transcriptC32F10.5 Source_evidenceePCR502WS150 Sequence/Annotation Release
WB_DNA_textTH:12-g5502ttatcatccgcactcatggacttccactttgctccggcttttttagcaacatctccgagtgtatccccatcttctttcattgaattacgattggcattgaaccagatgatatatgcagtggttgctcgtttcggctcatttggatctttagttttctttcctttcttcacagctttctcctttaccggcttctctttcttctcgcgtttattcttcttttctttactctccttcttttttggttcaatattctcttcatctggatcagattctccagttcctgaagcatctttctctgagccagaatcatattcatcgtcaggttcacttccagaaccttctgatgagtctttgtcattcttctgcttcttcatatccttatccaaatcataatcctcatcagtactttcatcatcgctgtcatcatcttgttcacgaccctctgctttcacagttgacttgtatggatcgatatcatcttcatcgctgcttccataaccag