Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:12-g9   

Cenix:12-g9RNAiCenix:12-g9
PCR_productcenix:12-g9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F26B1.3 Source_evidenceePCR526WS150 Sequence/Annotation Release
Chunk_score Abs_score484
Max_abs_score484F26B1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI63164216316992
Overlaps_transcript (2)
WB_DNA_textTH:12-g9572ctggaaatgactcgctgacacaggcggttatcgacttgggatcactcgatgaaattcttccattgatggaaaagacgcgatcatcaagcattgtgaaggagtgctgctggttggtgtccaacattattgctggaactcagaagcagattcaagctgtcctcgacgcaaatcttctcccagttctcatcaatgttctgaagtcgggagatcacaagtgccagttcgaggcttcttgggctctttctaatttggctcaagggggaacaaatcgtcaagttgtcgccatgcttgaagacaatgtagtgcctgctttgtgccaagcccttcttcaaactaacactgatatgctgaataatactttggagactctgtatactcttatgctcactgttcagaatgggtatgtttttattagataattagcactctcaaaaatgtgattccagttaccctcacaaagtggacattcttcacgaccaagtcgaagagaatggtggacttgacagtttggagcgcctccaggaaagtcaatcggagcagatctatactcaggcttaccgcatcatcactca