Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:12-h9   

Cenix:12-h9RNAiCenix:12-h9
PCR_productcenix:12-h9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F28B12.3 Source_evidenceePCR504WS150 Sequence/Annotation Release
Chunk_score Abs_score462
Max_abs_score462F28B12.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII59221225922672
Overlaps_transcript F28B12.3.1 Source_evidenceePCR504WS150 Sequence/Annotation Release
F28B12.3.2 Source_evidenceePCR504WS150 Sequence/Annotation Release
WB_DNA_textTH:12-h9551gaaccatccacaaatggaccgcttctcacagaagttgtagtgttcaacagaattctcaaaaaggaattaattgaatcttataagaagaaaaagaaaattagctggatcggtcttccatacctcattgccaatggatattttacatacgaatcggaaaaaatgcgatatatgatcattccgaagtatgcaacatcattggaagctgtaagagagactaacggtggtactctggctatgaaggattcattgactgtcgcgagctgtattcttgatgctctcgagtacttgcatgaatcggtttgtgaacattttcatttaaattgctgatattcttctttgttcaggactatgctcacgcagatgtaaaggctgccaacattcttctagaaaaacaaggagtgtattcaacagccgttcttgtggattttggtttagctcatcgcactacgaacaacgtcgacaagcctgataagaaacgagctcacaatggaacatgcatcttcacctcaactgacgcacatcgtggtaacaatccatcattccgtggtgat