Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:121-b3   

Cenix:121-b3RNAiCenix:121-b3
PCR_productcenix:121-b3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F41E6.4a Source_evidenceePCR723WS150 Sequence/Annotation Release
F41E6.4c Source_evidenceePCR723WS150 Sequence/Annotation Release
Overlaps_Gene F41E6.4 Source_evidenceePCR725WS150 Sequence/Annotation Release
Chunk_score Abs_score642
Max_abs_score642F41E6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV86100258611509
Overlaps_transcript F41E6.4c Source_evidenceePCR725WS150 Sequence/Annotation Release
F41E6.4a Source_evidenceePCR725WS150 Sequence/Annotation Release
WB_DNA_textTH:121-b31485gcaccttccgaccaaatctatttatttttaaaaaatgagatgagttagcaactgacgatcaagcgtctactctctatctctcacttcctgcgcctctctgtacttcgatcgacattcatttttctgcctttttcggtgaccttgaaccaagtgttatgacgaactgaagttgataatggggtcacatttcatactttcttcgcgggtctatgaaaatgttacgcgtgttgtgattagtatcagaattttattttttttaataattcaggataactcctctttaatttttatgctcagacatcactcttccgatttggaattgtagttacattttcggaatttattaattatctctaatttaaggaatgtcggacacaaaagaggtatctgatgatccgatggagcttggaacgagttcaacagttatcgctaaggaggaaaatgacaaggtgaggaaaggttgttattgttgactctgcacgtttagttttctaactcacaatttctcgaccaccttgtttgtacggatattttccgtagtctgacagagtgcgagagagttcgagagtaagaagatttcattatgaattggtgaggtcataaagacgatttcgccgagaaatccccgatatcctcacaggaattagctaaatatatcaaagttttttattttcaggaaagcctgaaaagaatggaagtagacgatgagaaagaacctgaagaagaaatcgttgagaaaactgaagagaaacaggaagaagaagacgtgacagtaaagctagaagatgaaacagaaactgaggtggaaagtgtggatggtggtcaagaagaaaaagaagttgttgatgaaaaacaggtggatgcagagcgagtaaataccaaaacagaagagttatcaccgaaaaaagaagttaaagcggaggaagatcctgaaactgaaacaaagaagaaggatccttctgagcaaacgaatggtcaggtcaaaaagaaaagtgataagcagagtccaaaaaagaaagagaaatctgagggaaaagaaaatagtcccggctcaaagctcaccaacagagatcatattcttgaccatcttgatataaaacgagtaagtaaaatgaaaaattgaattaaaaagatataatatggtttcaggacgcaaccaaccgtgtgaagctttacgttctctgcgatcaacgaatctgggaggaccgaggtactggtcatgtcgtcactcatcagttatcagctgaagatggagctccgtcgaatgctggaaatacaatggtcctcgtccgacttgaggggcaaagtgagtttattcgagaaaaaaacgactaaaattgaacaaccgaaaatgatcaattgcaatgttttttgttttctagataaaaacatgctcgagtcacggattcagatggacacagtctaccaaaaacaacaggtgagaatttcaatattaaatgactctaaacgtaggtggtggtgagg