Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:122-a4   

Cenix:122-a4RNAiCenix:122-a4
PCR_productcenix:122-a4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20F5.2 Source_evidenceePCR413WS150 Sequence/Annotation Release
Overlaps_Gene T20F5.2 Source_evidenceePCR418WS150 Sequence/Annotation Release
Chunk_score Abs_score362
Max_abs_score362T20F5.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI39086743909265
Overlaps_transcriptT20F5.2 Source_evidenceePCR418WS150 Sequence/Annotation Release
WB_DNA_textTH:122-a4592gcattcgaagtcgcttttctttccttttttctcactgaaagttgaattttattattttattattcttattttcagacgagatggctggtatgcacttcttggtgggaatttccaccgaaaactacgtgattttggccgcagacaaagccactttcgcttatggcgctattctcgctgacagcggtaaggctgagaatccgggatgcaaaaaatattcaaatttatattttagaaaacgacaaggaatatagactgggaaagaagttgacaatgatgtgcatcggagaggaaggagacgtcgcacagttcggagactggaccaagagaaatcttcagttgtactcggtcagaaatggttacgaggtttcaccatcatgtgctcatcacttcgttcggcgcagtatcgccgaaggtctccgctcgcaagatcactacactgtcgatgttctgattggaggatatgatgacaaggaggacaaggctttcctaggatctgttgattacttggctaatggactcgggcaacaggtattcagcaatttattatcttttagtcaaaataaagaattattattcagccgtacttgttccg