Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:122-h2   

Cenix:122-h2RNAiCenix:122-h2
PCR_productcenix:122-h2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene D1007.6 Source_evidenceePCR410WS150 Sequence/Annotation Release
Chunk_score Abs_score347
Max_abs_score347D1007.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI45839694584478
Overlaps_transcript D1007.6.1 Source_evidenceePCR410WS150 Sequence/Annotation Release
D1007.6.2 Source_evidenceePCR410WS150 Sequence/Annotation Release
WB_DNA_textTH:122-h2510cgaatccggctctgtagactggggctcctcctggtccagcctcggtgaccttctcggttctgtaggcttcacggtctcccttctcgccttgagctgaatattttcagcaatcaataaaagtacttgtaggacaaaacttaccggcgcgtggggctctatcctcgtgtgggacacggatctctcttggcttggtcttgatggtggctgggacgatctcagctggaagagcgaggtactcacggaggtacaagattccggcgtcggtcaagtaccagtagtagtggcgccaggcaaattgctccttaaccaactcgcgggaggcaagagactgtaatcacaatagattattgatttttttaattatgggaaaaataactcaccttcaaagtcttgatgacctcaaggttggaaactccctcgatgtttgggtgagtcttggcattgaagtctttcttggcgacagtcactccctcgttgaagaggtactcatagatgagcttggtgtggctt