Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:125-c7   

Cenix:125-c7RNAiCenix:125-c7
PCR_productcenix:125-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSD2024.7 Source_evidenceePCR364WS150 Sequence/Annotation Release
Overlaps_Gene D2024.7 Source_evidenceePCR379WS150 Sequence/Annotation Release
Chunk_score Abs_score337
Max_abs_score337D2024.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV72412777242389
Overlaps_transcriptD2024.7 Source_evidenceePCR379WS150 Sequence/Annotation Release
WB_DNA_textTH:125-c71113agagtccacgagcaacgtcttccatcaaaacattatcacggagttgtgaagcgacaagaatacgttgtggaacgattgaacttgtgttcaacatcatatttgtgtagtccttgggaagacggaacggaattccccaatattgggcagagaagagcaaatctttgtgcatgtacttttctttgataggaatacggagtgggagaccggggttttctgaaaacttgcagttatatgatttagaaggtacatatcaaacaactttctgatgattagcacgattcgaaaaaaattttcaaaacaattatgttatttatcaatgctcctatacttataaaattaccaaatatcacttttccaaatgtctcgaaattgctttcaaatagtccttttagggacatttggcaacttatcaaaacgttcactgatcattttgaaaaatcctgaaatttttggattgtcttattatgttaatatatgtcatgttcaactattataatgttgaactattgttgaactatttaagtgtatttatctattctagtgcccttcgtcagattaaagcagattttaagaagtagaagtagccgaccttatgatataaatagatagaggtgcattttttagaaaataataacatacaggcttcttaaggttttgcatgtccttttccagaagtaaattgaaagcttttattttgacatttcaaacggaattgttagagggtcatggtttaaaaaccttactttaaaaaagctaattccatttttttacggatattagagaaatttcaagacaaaaatacaaaaactcaccagtatgtctgacaacaccagcaaaaaagaatggtttcatctgaattggagtcttccaaacggaacgatgacgagtgattccttcgaatccaaagtaactgtacggagaaatgacatcgaagaagaatttgaccacttttcggttcggcattttgaaacttgaagtctgcaaaattcatgaaaattcagcaattattttaaaatttttcgacaaaaaagcgaaaaaaaaacagaagcttatgatttttctaaaccttaatgagctccagtactaaaacaacttgaactacttcgggacgct