Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:125-c8   

Cenix:125-c8RNAiCenix:125-c8
PCR_productcenix:125-c8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST01D1.4 Source_evidenceePCR357WS150 Sequence/Annotation Release
Overlaps_Gene T01D1.4 Source_evidenceePCR384WS150 Sequence/Annotation Release
Chunk_score Abs_score323
Max_abs_score323T01D1.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII177217177905
Overlaps_transcriptT01D1.4 Source_evidenceePCR384WS150 Sequence/Annotation Release
WB_DNA_textTH:125-c8689tagttgttgtggacggggttcaagtacttatccttgatttccttcaaccttacgagagaagaagcgttgaattttgacaaagttctgaaaattttaaatttttacttaaaattgtgtgaatgcttttggattatttggcatgtcacaaacatttttgaatatttttaaaattagtttaagcttttttacaagttttttacgaccaagtgcattttaatcccaaaaattgcatatagaaagttattgtaatgattcaaactgatttttagtgggtcaaatggataaaatcgaaacccatggcaaacttctataaagctcaaaattattctttcgtagtagctctttatgattatgaaaatctgtagtcacaaaattcacaaaatttacctgtggagtagtagtgaatcgatgagacaatccctttggaatcacaatcaagtctcccttctcgacctgcacacgaatccatgagtcatcctccggctcgacgtcataatagcatgttccctcgacgaccaaactgatcacatcctctttttgtacttgtggctcgtagaattgttccatcttatcatcgaactcgagcattgtctcactgacagtgaacatatcagtgaatgttacattcttctcggttttcactgcagaaaggcgtttcttcatcgaagcggtgtcatcaaggtccacct