Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:125-d7   

Cenix:125-d7RNAiCenix:125-d7
PCR_productcenix:125-d7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF53F10.1 Source_evidenceePCR364WS150 Sequence/Annotation Release
Overlaps_Gene F53F10.1 Source_evidenceePCR364WS150 Sequence/Annotation Release
Chunk_score Abs_score343
Max_abs_score343F53F10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI38342253834648
Overlaps_transcriptF53F10.1 Source_evidenceePCR364WS150 Sequence/Annotation Release
WB_DNA_textTH:125-d7424ttcgtaaacggagatcctggattgtctttccatcggtttcaatcttctctcgacacttgttcaactcattcgcctgatccttcaggaattcattttcagccttcaattcttcatttatatcggatttagtcgtctcaacgggcggctcatcgacacttggctcacgaagaactgcttcaatttgagccgccgaataacttttgactagaattgatggaggatcacatgaaattgaatgaattgtctgaacaactgcatttcgtttggttccgtcgatttctggtttttgagagatttcgagttttggctcgtcggattccgagtcgacgtggtacagttgttccgctagaaatctcttttcttcctgaaaaaatgtttaaaatttaaaatttagcaatgggtccaggcacgaatgaaatgttcc