Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:125-h5   

Cenix:125-h5RNAiCenix:125-h5
PCR_productcenix:125-h5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC33A12.1 Source_evidenceePCR351WS150 Sequence/Annotation Release
Overlaps_Gene C33A12.1 Source_evidenceePCR356WS150 Sequence/Annotation Release
Chunk_score Abs_score335
Max_abs_score335C33A12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV95243609524953
Overlaps_transcriptC33A12.1 Source_evidenceePCR356WS150 Sequence/Annotation Release
WB_DNA_textTH:125-h5594gttcttcgggtctctgaacgctttcaaatgaaagcaacattatgaaatatttataaattcattattttcatagatattcgattatttaacattgaaacttgacgcacctgttcgatgacttcttcgatttgtcccattccaattttctcctcaagcttcttaatgtcgttttcggcttgaacaagagccaaacgctgctttaccacctaaaaacatattgcataagattgcggtagaaacaataataatttcttacagcttcagtatacttgcggtaagcagcatcccgtggaatttgttcaagggcgcggagaattctgccatacacaacagtcaacgcacgatgtggatgctcattgacaaaaagtccagtaattcctgtagtcttcttgtggaaatcctcggaaaccttgctcctggccttgaaacggttgatgtaagggttctcgtacatggatctctgttgtgtggcacgagccaccgccgtacgcaagaagcgggacgacatcacctgaaaaacaaatttgaaaaatatttatgaaagaaaaacgcgagtttattgcttaaaaacttataaatccgtttctaagcgcg