Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:126-h7   

Cenix:126-h7RNAiCenix:126-h7
PCR_productcenix:126-h7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF38A1.8 Source_evidenceePCR474WS150 Sequence/Annotation Release
Overlaps_Gene F38A1.8 Source_evidenceePCR474WS150 Sequence/Annotation Release
Chunk_score Abs_score453
Max_abs_score453F38A1.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV12381251238731
Overlaps_transcriptF38A1.8 Source_evidenceePCR474WS150 Sequence/Annotation Release
WB_DNA_textTH:126-h7607cggtttcggtgaaaactagctaattttcttcaatttttcagcgaatttcgtcgaatttctacctctttcggatcggatctatcgagatttttgacgtcagccggttttccactcaaagcccaaactctagcttgttttcccttgggcttaggtgaagtaggctcttctgggccttttttcttcgtatttccactcattttcttgaacatttgatcccttctacgtaaaacttcttcatccgggcttccaggtggtgatgctgaattataatcagttgcagacgattcttcggcactttccaccggctttttcggcgttttttcagcgtttttcgcggatttttcggcgtttttctgtcccgggcggctcacaatcagcgaatcgatggttttttgagattttgcagattcttggaacgttttcggctttttgacggtgttttcagtggcacgagcactttttgcagcttctgagagcacttcgtgaaaggtttcgtcgaaatttccgtagatattcgacggaggagtggttagagcctggaaaaatagattcttaagcttttttcgcaaaaaattagtttttctcagctaaaatgccacttttccgc