Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:128-b4   

Cenix:128-b4RNAiCenix:128-b4
PCR_productcenix:128-b4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST09A5.6 Source_evidenceePCR373WS150 Sequence/Annotation Release
Overlaps_Gene T09A5.6 Source_evidenceePCR373WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII78539557854645
Overlaps_transcriptT09A5.6 Source_evidenceePCR373WS150 Sequence/Annotation Release
WB_DNA_textTH:128-b4691gggcacggaatttcttgtaaatctcaatcttgccattcacctgaaatatttaaatatttaggaaaaaattatgaaaaaagaaacaaaccgctttattcttttccaaggttttctccatacaatgtttcgaatacagacatggattttttccatcatcaagatatggtaaaagatccaatggaaccttcttatcactaaaagttcctttcattctatctagatcctataaaatttgaaaattaatttttaggactattgctcaaataaattcacctgcaaacctctaactagtgtgtatatccggccatttagagcgtcttgatactttgtttgaaaattggaagcaagatctccgatgaatctcgcattttcttggaattcttccaatttcttttccaattgcagtattttgtcatcttcttgttttctcctctcctcttcacgctctttttcagtttttcttgccaacttctgaaccatgtactttttagtttttttgtcaagcgaagaattttgttaatctaactggaaaactcaaaaacgtttaatttcgatattttttaaaaattgtactcgatattttaactatgatcaaatttttaaaatttttcaacaaaatgtttcaaacttcaacgtgtttttggagaaaaaaaatttggattcagctctgatcctcggtttttcggtttta