Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:128-e8   

Cenix:128-e8RNAiCenix:128-e8
PCR_productcenix:128-e8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54A3.6 Source_evidenceePCR311WS150 Sequence/Annotation Release
Overlaps_Gene F54A3.6 Source_evidenceePCR311WS150 Sequence/Annotation Release
Chunk_score Abs_score290
Max_abs_score290F54A3.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII22268722227249
Overlaps_transcriptF54A3.6 Source_evidenceePCR311WS150 Sequence/Annotation Release
WB_DNA_textTH:128-e8378tgcaattttcaagccaaacagagaactttttgagcttaaaagctctaaatttccagcttttccgtaccattcgacccaaaactggtccatttcgaacaaaatgctctgatgctcgcggagcagcagccgccaatggtgggctcggtggtgatacaggaggatagacgactctgtccagttgaacaattcccggtggtggtagatcaacttttggcggcggcggatacgacgggttactgtagttactactgtaggtggtggatgacgtggtggatggttgtgctccaagtgggacaccaaatgggctcacagcagggggtactgtagatgaagaagaagctggtgctggaggtggtgcttggaagaaataaccggctg