Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:129-b1   

Cenix:129-b1RNAiCenix:129-b1
PCR_productcenix:129-b1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26D2.15 Source_evidenceePCR303WS150 Sequence/Annotation Release
Overlaps_Gene F26D2.15 Source_evidenceePCR303WS150 Sequence/Annotation Release
Chunk_score Abs_score261
Max_abs_score261F26D2.15
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1644032016440895
Overlaps_transcriptF26D2.15 Source_evidenceePCR303WS150 Sequence/Annotation Release
WB_DNA_textTH:129-b1576cctcttctaccgtctgcgtctcttgtaccatcaatgtcacagtttcggggtgggtatataaacatactcacccaataatttacatgtcacaatttcgagagattgctcattatggctcgtttttctggaaaagttgctctgatcacaggtgagtaagactttactttattttttgaaagaaatctcatccttaaaaacatctttaatgtcaagacaaaggctttaatgtcaagattgtgctcattggttcaattttgtcaaacaaaaggcttagaatttcaatttcaaaactcatgaatgtttttcttaggatcttccaacggaattggccgtgccgccgctatcctctttgctcaacaaggggccaaagttaccataaccggaaggaatgctgagcggctgaaggaaacccgacacgaaataaaaaaatctggaatcccggcagaaaatattcttgcgattgtagccgacgtgatcacagatgaaggacagatgaggcttatcaacgatactgttcgaaaatttggtcaccttgacattttggtgaacaatgccggaggagcattgatggatgct