Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:129-h3   

Cenix:129-h3RNAiCenix:129-h3
PCR_productcenix:129-h3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF58E10.6 Source_evidenceePCR360WS150 Sequence/Annotation Release
Overlaps_Gene F58E10.6 Source_evidenceePCR360WS150 Sequence/Annotation Release
Chunk_score Abs_score281
Max_abs_score281F58E10.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1401894214019864
Overlaps_transcriptF58E10.6 Source_evidenceePCR360WS150 Sequence/Annotation Release
WB_DNA_textTH:129-h3923atcgaaaaattgctccgagaaaatacaatttttggggaagacatatgaagaacatgctcaaaagacaggcattgactattgtattatcagtggcaaatacaaaatattcccgacgattgagaacttcatttggaatacatggatttatctgtaattcactttttggttaaagctttcaaaaaaaaaacgaaaactcacatttttcacatattgctttgctacttcaggattcggtagttttaaatatgcgggaataataaacgtcactgatatagtataatttaatacaacatataaggtacgtttccagttcagtgatccgtttgttgtatgcccatgtattagtcggtgatagcgatcttcgaagaatatggttacagccacgcacatcactgaaatatattgaattgttcggttcctctcaaattgaataatttaaaaaggaatagtagcttgaaaaccctagagtaaacattaaattcgtaacttggggaacttgctgtcaaactttggcagttctctgtccaaccttccaacaaacttagtcaatcttctgccaaactttggaaacttttggtcaaacttagacaacctactgtaaaattctgggatttttctctcaaaccttgacaacttactcactctcggaagttacaaaggttcgacagaaaactgccgaaattggacagaaagttgtcaaaggtgcgttgccaaaatttggcacgaagttttctttaaataaaaagccaaagacatcacaaaaaaattgggaatcaaataatttgttattgagattagattaattcatatcgaaactgaaaacataataaagcttctgttttcaataagacgttttatatttattatactattaccattagttagccaattcaaaataaactaacccccaacaaaaacacatc