Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:13-c7   

Cenix:13-c7RNAiCenix:13-c7
PCR_productcenix:13-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1248.6 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (13)
Overlaps_transcriptZK1248.6 Source_evidenceePCR419WS150 Sequence/Annotation Release
WB_DNA_textTH:13-c7608cagtggagagtgtcgaaccagctgatctagaggataagggacaagtgagtctatttttgtttgagaaagaaaaacagaggcattaaaaatatttattttacaaggaacctatgggttatactcgattggcaggttcttacgacggaccataccgtctccttggaaccactctcggcggaactgcttggcagctccatccggggtgttggtccattcgacggtgatacggtcgttgttggtgtcctcttgtccaaatgcgaatgcatcacacgaaacagccaagagcacagcttcctttgggtcgagaactccacatggtggatcaactccaagtctcttcatgttggtggtcttgataccgtatccaatacggcgagcagaagagttgatcactttaatgtgatacgtgtgcttgtcgtcgtacggagcattgaagacgatctttgtacccggctgggtctggatgtctcccggtgggacggattgggccatggcgacttcttgtaggagtttttgaaaactcaatgaagcatttgtgaattcttcgaacttatatagggggcttcttatcagctacgtagatcttcaccgtttggtcttgacgtttt