Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:13-f11   

Cenix:13-f11RNAiCenix:13-f11
PCR_productcenix:13-f11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR05F9.13 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (35)
Overlaps_transcriptR05F9.13 Source_evidenceePCR461WS150 Sequence/Annotation Release
WB_DNA_textTH:13-f11702agaagaggcacattcggaaacatcaacttttttttagagtataagaaacaaaaacacagaactagtagaacaatctttattttataaaagcccagttcacagatcctatgggttgtactcgattgggaggttcttacgacggaccataccgtctccttggaaccattcacggcggaattgcttggcagctccatccggggtgttggtccactcaacagtaatacggtcgttgttagtgtcctcctgtccaaaagcgaaggcatcgcaggaaactgccagaagcacagcttcctttgggtccagaactccacatggtggatcaactccaagtctcttcatattggtggtcttgataccgtatccaatacggcgagcagatgagttgatcaccttgatgtggtaggtgtgcttgtcatcgtatggtgcattgaagacgatcttcgtacccggctgggtctggatgtctcctggtgggacggattgggccatggcgacttcttgattgggagttaaaactcacagtgaagtttatgacaaaacctgctcaatttatagcaaatttctctcttatctctgtcctagatcttcactttagccacgtcatgtaaagttcacataaacattaatatttttttttaatccgtgtaacttccattgaatttattctatttccaatttttatcctctcatgcggaagaactc