Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:131-b8   

Cenix:131-b8RNAiCenix:131-b8
PCR_productcenix:131-b8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06B4.4 Source_evidenceePCR330WS150 Sequence/Annotation Release
Overlaps_Gene K06B4.4 Source_evidenceePCR330WS150 Sequence/Annotation Release
Chunk_score Abs_score254
Max_abs_score254K06B4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1567232115673570
Overlaps_transcriptK06B4.4 Source_evidenceePCR330WS150 Sequence/Annotation Release
WB_DNA_textTH:131-b81250gcaaatttcaggcgattcatctagtcacatccaccatcttctatttctacatttatattcgtttgaacgtcgaggacaatcaacagcttttgtattgttagtattttagaattttacttgtagaatcaatttcaaaattaaaactttcagggacaagccgcctggctccaatttcaatgttatttatgaccgggttgctgatgatttctgtgctgattatgtgcaagatgaggttattttttggtctatgggatacaaaccctgaatttgttttatttcagttttttccaatcgtccaagaggttgctggaacatctgtacgaagttgaggatactggaggaaagaaggcagtttaaacgggaaaatgaaatacttgtaatttttcgcatttatttattagtgaataaacttgatgttttgaaaaattataaattttgcttataaatgttaattaccataataactcaaaggctgatcaaaggtgtactgagatttttcaaaaagaactaaacatttgcaacaaaactaccaaaaaatatttgagaaaaaagttaattttccctttagaaaactatatttcaactcttgaaaattgagaaatttgtctaaaacccgtaaatttcgcgtctgggtaacaaaaaatgttcaaaaaatttatttattgaatcccgtgaacattcatttttttatttagttttttttctaaataaaaactgccgtgtaatcaattttcgtcattccttcgttcggtcacggccgcaaaatgtcgcgaattgtggatggcatcgaaaattttctattcaaacttggcattacttttgaggtgagctataggttccagagttcttcgtttgcaaaaatggaagagtggctgtgtgtgaacctcggccgtggacagaaaaatggagttatgcaatcgcgctccgctacacaaagcgattctcgctctcaaaattgacgagctttcaaaattgtccacaatcctcagagcttttgtgaaaaataactgagctctcaccaaaatgaggataataggctgtaggcaggcatgtaggcattgctctccaaaatcgaaatgtcgcggtcgaagcccgtaaattgttcacagtctgaaaatttcagaatcaatattcaatgaccagtgtcggctacatgtgcctgtatctctggcagacgatgctttatctgtttgattcattctgcgcagttaccggagatcgcaaagtcgagcgttttgacaatatcggct